Description :
From Genome Similarity Track
Location :
Scaffold_62:93417- 95144
Transcript NameFunction/comments
g17426.t1ETI46398.1 hypothetical protein F443_09210 [Phytophthora parasitica P1569

Sequence
1727 bases(100 bases per row)
CCGTGCGTGCTCAGCTGGAACAACCTCAGCTACTCTGTCGCCTGTCGCTCGACGGCCGACGCGCCTGCAGGCAAGAAGGTCATCCTGGACAACGTCCGCG
GCCGCTGCGCGCCTGGAGAACTCACGGCCATCATGGGCCCGTCCGGATCGGGCAAGACCACACTCGTGGACCTGCTGGCCGACCGCATCAGCTCCGGAGA
AGTGACGGGCGACATCGAACTCAACGGTGAGGCCCGCGTGACCAAGACGTTCCGCGCCGTGACGAGCTACGTGGCCCAGGAGGACTCGCTGCTCGGGTCC
TTCACGGTGCTCGAGACCATGCGCATGGCCGCCAAGCTCAGTCTGCCCACGAGCGTCTCGACGAGGCAGATCGAGGCCCGCGTGGACGACGTGGTGGAGG
CCATGGGGCTGGCCACGTGCCGCCACACACTCGTGGGCGACATCTTCCGCAAGGGCCTCTCGGGCGGCCAGAAGCGCCGTCTTAGCATCGCCATCGAGCT
GCTGTCGAACCCGAGCATCCTCATCCTGGATGAGCCCACGAGCGGCCTGGACTCGAGCGCCACGCACAACGTCATGAAGTTCATCGTCAAGCTCTGCGCC
GAAGGCAAAACCGTCGTGTGCACCATTCCACCAGCCTTCGTCGCTGGTCTACGACATGTTCACCAACGTCGTGGTGCTGTCGGCGGGGCAGACCGTCTAC
TGCGGCCCGCGCGGCCACATGATCCCGCACTTTGCGTCGTCCGGCTACGATTGTCCTAACTACATGAACCCGGCCGAGTACTTCATCAGCCTCGTGAACA
CGGACTTCGACGACCACGCGGACGTGCCCAAGCTCGTGCAGGCCTACGCCCAGAGCGAGACCCGCAAGGAGCTGAGCACGCGCATCGAGAGCGACCGCAA
GACGCTGCAGCACCTGCCGGACATCGAGCAGCCGTCGCCCTCGTCTCTGCGGCAGTTCAAGGTGCTCATGTACCGCAACACGCTCAACAACATCCGCAAC
CCGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAACGAGCTGACGGAGGAGGACC
TGGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGCGCCGTGTTCGCTCGCGAGCG
CGCCAACAGCTCGCTGAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGGTCATGTCGACGGCGCTGGTG
GTGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTCGTCGTGTCCGAGTCCATGATGCACGTGATCGGGTCTGCGG
TGCCGCACTACATCATCGGCATCGCGTTGGGCGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCTCGCGCCTCCATCCCGGACTA
CTGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGAGAACGAGACGTCGGACGCTGCGAAGGCCATT
CTGGCCAAGTACGGCATGGAGGACGTGGACGTTCCTCGCGACATGCTGTTGTTGGTCGTGTATATTGTTGCGTTCCAGGCCATCTTTGCCTTCATCCTGT
GGAAGTTCCACACGGGACGCCGTTAAG