Description :
From Genome Similarity Track
Location :
Scaffold_304:9341- 10575
Sequence
1234 bases(100 bases per row)
GCGTCCTCGCGGCTCCTCGATCCGGTCACGCGACCGCGATCGTTCTTCGGCGTTCGTTGGCGTTTCCTCGTCGGAGGAATGTTCTCGTACCATCTCCAGT
GAATAGCTCAACAATGAACTAAAGATATCTTTGTATTGTCTCCCGCTTCTTGGCTTTCGCCCACGGGACCTTCGTCAAGGTAGCAAATATACACACTGGC
ATTAGTGAGGTTAAACACGCCACGAGGCGCCTACTGACTACAATTCACTAAAGTACTCAGTACCTCCACTAAGGTATCGGAACCTTTGACACGCCACACA
CACAGAGTGTGTGTTTGCAATGGGTCAAACTAACGCGCGACCCAATTGCTCTGCACGCTGCAGAACACACAGAAAACAATGACATCAACATAAACCTACC
ATGCTCTACTGGTAAGAGCGTGGTCTCCGAATAATCTGCCATCCAATGAAGCAATAGCGTTATCCGAGCATTATATTAGAGAGGTTTAGCAACTCATCTT
TGCATTACCCTCATCATCATCTCGACAAATGTCGTTTTCAGGACAATGGTAATGACAAAATAATTTACTTTTCGCAACTTATCCTCATCTGTGCCATTGC
ATTGCTTCCGGTTAAATAAGTTATTCGGATGCATGCTGTGCTGCTTGAAGTGCGGTGACTTCAGTCACCGTGTGGCACGGTGCGAAGCCGAAATGTTGTT
GGCAGCGCAAGTCAAGCGCTGGAAGGACGGCATCAAGGTGCTGGTCAACCAGCCGCAACGACAGAAGACAGAGCGCGGCGTGCTCTTGGAGAATATCGTC
CGCGTGGACGATGTGCTCTTGGACTCTGGTTCGGACGTGACCGTTGTCACGCGCGGCGTCATGGATGCGTTGGACGCAGCCGGTGTCAAAGTTGGGACCG
TCTCCCATAGCGTGCCGCATTTGGCGTACCCGTATGGCAGTGACGCCAAACCAGTTGTGATGACGCGCAGCGTCAAGTTCAACTGTGTGATTGCTGGACA
CGACGTGTGGGCCGCTTGTGTTGCGCGGTCTGAAGGCCTGGGTCGACGACGCGTCGACTGCAACCGAACTCATCGTGAGTCGCCCAGTCATGGAGTTACT
GGGCTTCAGCGTTGAAGACCTCCTTGTCGGAGCAAGGAAAAAGAAGGAAGAATGGGACGTTTTGTCCGTGTCGACGAACGAACTGTCCAGCATGGCGAAT
GTCAAGCGCCTGATGGCGGAGAAGTTGCCTGATG