Description :
From Genome Similarity Track
Location :
Scaffold_225:9340- 12049
Sequence
2709 bases(100 bases per row)
AGATACGAAGGCACACCTATTCGCCGCGGTTTATAATTCGATAACAGCCAAAAGGTAGCAGATTGCAGTACTGAAGGCTTGGTATCCTTCACTGCATAAA
GCGGAGCGAGGAATGCTAGCAACATTTTCGAGGAGGCATACGTAAAAGTGACCTGTACTTTTAAGCAATGGAAATAACATGCGACAGTAACCAGTAATGA
CATCCAGAATACAGCGTGGATGCTGACAACTGTCTTGGATCGTATGACGAACAAGCAGCGCTGGTCGCAGTTACCAGTCATGAATCATCAGCCGGCTAAA
ATCAAGGGACCTTTTCACCAAGCCAGGGCAAAAGTAATTTAGAGTCTGGGTGACAGCATGAACAATATATGTTTAATCCGGAGAGGTACACTCAGAAAAT
GCAGCCGGTTGAGCGCACTCACTGTGCGGTCGCGGTATTGGGGATAATAGGGAGCTTAGAGGAGGCTTGTGGACAAGTGGCGAATTATTCAAGGGCTGGC
AGAAGGAGATATAGTGGGAAGGAGACTATTACCATTTCTCAAAGCAATTTTATTTCTCAGGAAAAACTTCGGCTGCACAGTACAATTCCAGCTCAAGTTG
AAGGGAAACTCAGCTTTAATTAAGCGGTAGAGGCACAATTTCATCGAGTCGGCTACGCAGGCAGGTCCTTAAAGAAAACATACTGTTGGCAGCGAAGTAT
GCTCGGGTGAACCGCAACGACCTTTACGATTTTCATTGTACCCTCAAGAAGATCAGCTACAACCATGCTTCGAAGTCGATTCATCTGTTCTTTGTCCACC
GTGCCACGGCAACAAAAATTCAATACACGACGGCTCGGTTCACGCGAGTGGAGTACCACTTGAATACCAAGCATTTCCCTTCTTCGGGCTCAGCCTGGGA
GAGACAGCAAGGATCAGTGAATTTCTAGACTCTTCGAAAACTGGAGTACGAGATATACCTATACAATATTTCGAGGTTCGTCGATATTGGGAAGATATCA
GCGTTTATCAGTAAGCACAGTCCTGTGAAGCATGATCTCGAAGACATGGGTTGTTGTACACCACTGTCTGGAAGTGAACTTACTTGCTTGCTGGGTGTTC
GCAATCTCTACAGAGGATTGTACGCTGGAATTGGTTTGGAACCACCATCATTTTAAAGCATCCAGTGGTTGGTCTCCCGCTACAGCGCTACAAATGTGGT
AAAATCGGCCACATGTCGGCATGATGTGGCTACACAGATGATCAACTGAAAGGCAGTGGATGTTTTAATAGCCACTGAACAGGAGTTTGTGGCACTTGAT
GATGCCGCCAAGACTTTTGCTAACATGGAGGATATGGATGTTGCAGCCTCTTCAACATGACACAGCGTCTGTCCGGAACCGTACGATTCAACCCCATCCC
ACGTCGGAGAACAGAATCCAATCGGGTCTGTCCGGCGAGATGATCAATTCCAATCACCCAAGTACAACGGTATTTACGCAATACGACCGACCCACACAAG
AACGATCTCACGACTCTACCCACCCGAAAGAGAACTTAATGGATTAAGGTACCGTTGCGTGGTAAACGTCGTCTATTTGCAGCCAAGATTTCGCTAGCAC
AGCAGCCCGAAGGACGACCTACACAATATGACGTTCGATCAGGAGACGATAGTTTTGCCTTGGATGGTAACGAACCCACACCACCAGACAATAAGGATCA
TGTGGTGGAACCTATAGACATATCGCCGACAGAGGAGACCGCAGACCAGACAGCCAATAACGCCAAGGACCCGGCCCAAATTCGTATATCAAGGAAGAAT
CCTCCTCCTATACCAGCTACCTTTGATCTGATCGGTCTTAGTCAGCAAGAGCGGACCTAGTTACAGAATCTCACTGCATCGGAGGAAGTCGAAAGTCACT
CACGCATCCCGGTTGCTAACCACATGGACATCTTTATGCGGTCTGAGGATGTCATAACTTCCCAGCTTGGGCTTTGGAAAGTCACTAAGCCGGCAACGCG
AAATCGCATTGGCTATAGACATTATTTAAGCTTTATTAAATACTGACCTTGGAGCTCAAGACACCTTGTTGACATCTGCGATTATTCGCCTTAAACGGGG
TATTACGTATACCGGCCAACTGCCCGTCTAGGAGAACGATTTTAACACGGAAACTCGAGTCTCTACACCCATAGCAGTTCAAAGAGGTGATTTGGGGATA
TGAGTGGTTTCTGCAAAGAGGCAATCAAATTGGTACCTGGAGGAATACGATCAAAGACCTTCCGATCGGAATGCGAACGTTACCATTCACGATTGGGGTG
GATGTGAAATTCTTTGTATGGAGGCGAAGTTTCTCCGACGAAATATCTATTTTATTGCTAACGAAGGCAAAGGCAATGGGGCTTGGTGATGCAGTCTCTA
CTGAACGAGTTACATCACTCAAAATAACAGTATTATATTATAACAGGAGAAAAACTGGTACTAACGGTCAAGTAATGATATCAAGAAATTGCGCAGGACA
ATCACACCATGACACAACCAGCACCCCTTGTACTGCGATAAACGGGACATCATTATTCAGCGTATGTTCACTAGCGAGAAGTAACGCCCCGCGTCTCTGT
TGAGCTATGAAATGGGCCAGGCACTCTGGCCCCAAACGAGTCATCATTATTGTCAGACGTATTCATGGGTTAAGCTCCAGATGATGAATCGGTTGATGAC
CATGATGAT