Description :
From Genome Similarity Track
Location :
Scaffold_34:93361- 101661
Transcript NameFunction/comments
Phyta_totarag1708myosin-like protein
Phyta_totarag1709myosin-like protein
Phyta_totarag1710conserved hypothetical protein

Sequence
8300 bases(100 bases per row)
ACTTGGCTTCAATTCACTGCCAACCTGCATGGATATTTAGCGACACAACTCTTGCCATCTTCGCTCAACCACTGCGCGCTACACGCCACAAGACATGATC
CGCCTTGTCGCCTCCTCGTTGGTCTCAGTGACTTTCCAACAGCTGGCTTTGGTAAAGAGTTTGGGACTGGGCAAGGGGAAGGGGACAATCGTATTTTGCA
CCGCGAGAGGCAACTTGACCATCACTTCGATTGGCACCAGTTACCTACAGTAGGGAGTCAGTTTTTCAACGGTCCAGTATCGGGCAaagcttgctgcagc
gtccgGTCGTGTGCGCGGAGAAGCAGTGCGGAAAATCTCCCGTGTGTATCGTCGCGTGTTGATAGGGAGCGCGCACTGCATTGCATAATATTGCATTGCC
GAGAAGGTGCTCTATTGCTCACTCGCTCTACTACGAGAGGGTAAGTCAGGTCAGGAGACCGTCAGGGGTGTCAGGTGGCAAGACTCGTCCTcccctcctc
ttcgtcttaTCCTTCCAGGCTCCCACCCAGTCTCTCTAGACACATACAGGCAAATCTCGTTCGTGGTGACACAGGAGTGTTGGTCTCTTTCCctccatca
gcagcatgacTGTGCGCCGcacggaggagctgcaggagtgGGTCTGTAGCGTCACAGCCACGTCCAACGACCATGGCGAGCACCTGTCGGTGATGCTGCG
CGACGGCCAgttgctgtgtctgctggCCAACGGCGTGGACCCGACGGCCAACCTCAAGGTGAACAAGCTCAACACGGTCTTCCACTCCAAGGCCAACATC
CGCCTCTTCCTCGAGTGGTGCAAGAAGCAGGGACTCAACGACGGGGACATTTTCCAGCCGGACGACCTGCTTGATGCCGGCGCGGACTTTGTGGCAGTGC
TGGGGACGCTTTCCATCctcttcgacagcttcggCACGATCGGGTACACGGGGGAGTACGAGGAAGACCCGGTGTCAGATGCAGAGTCCATGACGTCCAC
TGGCAGCTCGCAGGGCACGTCGCCAGTCAAGaaaaccaacagcaacaacaaactcACCAACTTCATGAAGGGGGGATTTTTgtcaaggaagaagaaacaa
tcgagcaagaagatggtGGACAAGTCTCCCGAGGGAACACCGCCATCGACTCCCCCGCCAGCGTCGCCGCAGGTGGGAGGGGGAATGATGTCTCCGCCGG
GTTCGCCGTTGGAACCGCCTTCACAGAAGGACATGAGGAGCGACAGTGGAGGGGCAAACGCCAACCGTCTGAACGCGTTCTTGAATGAAGTGCCAGCCGC
GCACGGATCGCCACTGACACACATTGAGCGTCCGTCAGGTCCGCCCAAGAAGGCCAATTCGGTGAGGAAGCCGCCGGCACCCAAGCCGAAGACGCCCCCC
ACTGTGAGAAGACCACCGTCACCCAAGCAGCCCCCCAAATCGCAACCGACTGGCCGTGACGCCCGCAACAAGTTCGCGGCCTTCATGAAATCCAACCCGC
CTGCTGTCGAGACGCCACATGCTTCGGGCCCGTACCCCGGATCTGGTGGTTCAAACCTCTCTCCCGCTGCAAGCGATAAGCCTGTTGTGTCGCCACCGAA
GTCTGCACCTGTCCGAGGTCGTGGCACCTCAAGCGACCAGTTCGCACAGAGCAAGGCTGCCTTCACTCAAGGTAACAGTAGTCCGAAGCCAGACATGCCT
GCTCCCGCTCCGTCGAAGCCATCAGTCGACACTAGATCTggcaacaagctcaacagcttcatgaagcAGCAACCGTCTGCGTCGCCGGATTCCTCGTCGA
AGCCTCGCTCGCAGAGCAAACTAGCTGCTTTCTTGGCGACGACAAACTCGATTCCATCGATTGCGACAACGCCGTCCGCCGCCCCGCCGAAGCCGACGTT
TGCCTCGTTTAACCCGTTGAAGAACTCGCCGGCTGGTGGCCGATCAGCTTCAAAGCCTGCGTTCAATGCAACTCCTGCGGCACCCGCTGCTCCGATGCCG
TTCAAGCCGCGCCACATGCTGGAGCGTTCTACAGGTCGCGGCAACTATGTCCGCAAGCGTCAGACGTACTGGGTTCCTCCTAAGCGCCGCCGCAAAAAct
tcagcttggagaagaagcgaaagGCTTTCATGaacgagcagctggagattAAGGAAGAACAACTTCGTCAGCAGGCTGCCGGCGCTGGAAACAAGCAGAA
CTTGATTGTGCCTGGTGTGCAGTGCTACATTCCTGACAAGGAGGAAGTGTGGCTACTTTCCGAAATTGTGGACTACAATGACCGCCGAAAAGAGGTGACC
ATCACGGCTTTTTTGGACTCGGGTGATTCGGAGCAGCGCGTTGTGGACCTCAAGAATCCGGACGTCATTCGTGCGGTTGCCGGACCGACAGCGACCGAAG
TGGAGTCACTTCCGGTTGCAATCCTTCACGACAACCCCGAGGGCGTGGAAGACATGCGTCTGCTCCGATATCTGAACGAGCCTTCGATTctgttcaactt
gaagcagcGCTTTGCTGCCTCAAAGCCCTACACGTACACTAACGACATTGTGATCGCAGTGAACCCGTACAAGTGGATTGAAAACCTTTACGGTGACCAC
CTGCACGAGCAGTATCTGCGGAAGCCGCGTGACTCGCTATCTCCTCACGTGTACTCGACATCGACGGCTGCCTACAAGCACATGAAGACTAACGAGATGA
ACCAGAGTATTCTTGTGAGTGGTGAGTCTGGTGCTGGTAAGACGGAAACGACGAAGATCGTGATGAACCACTTAGCCAGTGTGGCTGGTGGCCGCAAGGA
CAAGACCATTGCTAAGGTCATTGACGTGAACCCGCTTCTCGAGTCTTTCGGTAACGCCAAGACGACACGTAATGACAACAGTTCGCGTTTCGGTAAGTTT
ACGCAGCTACAGTTCGACAGTCGTGGTAAGCTGATCGGTGCAAAGTGCGAGACGTACTTGCTGGAGAAATCGCGTGTGGTGTCAATCGCCGAGGGCGAGC
GCAACTATCACATTTTCTATCAGCTTTTGGCTGGTTTGCCCAGTCGAGAACGGAAGGAGTTTGGTCTGGACCCTGACTGCAAGTACCAGTACGCCGGTTC
ACTAGCGGAGATGCAGATTCCTGGTctggacgacagcaagtgGTTTGCAGGCACGCAGAAATCGCTATCCATCATCGGTCTGGACGCTAACGCGCAAAAG
ACGCTTTTCAAGATCCTGGCTGGTGTTCTGTTGCTTGGTGAGGTGATGTTTGACAAGAGTGGGGAGGACGGATCGCGCATTTCGAGTGGTTCAGCACTGT
CACAGGTTGCTAAGATGTTTGGCCTTCCCACGACGAGAATCGAGGAAGCACTTTGCAACCGCACGGTCATCACGCGCAACGACAGTGTGACAGTGCCACT
TGCTCCTGTGGAAGCAGCGGAGAACCGCGATGCGTTGGCTAAGACCATTTACTCGAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCTATCAGC
ACGGACGAGAGCCGCATCAAGGGCCAAATCGGTGTGCTGGATATCTTCGGTTTTGAGGACTTCGTACATAACGGCTTTGAGCAGTTCTGCATTAACTACG
CAAACGAaaagttgcagcagaagttcacTACGGACGTGTTCAAGACTGTCGAGGACGAGTACATCCGCGAAGGCTTACAATGGGATCACATCCAGTACCA
AGACAACCAGGGCATCGTGGAGGTAATCGAGGGTAAGATGGGTATCATCGCCCTGATGAACGACCACCTTCGTCAGCCCCGTGATACTGAAGAGGCTCTG
GTCAACAAGATCCGCACAAACCACCAGACAAAAAAGAATggcgacgtgaacgagaGCATTGACTTTCCAAAGGTGAAGCGCACGCAGTTCATCGTCAACC
ACTATGCTGGCCCAGTCACTTACGAGACGGTGGGTTTCATGGAGAAGCACCGCGACACGCTGCAGAAAGACTTGCTTGACTTGATCCAGTTGAGCAGTCT
GCCGCTGCTCCCGGAGCTCTTCGAAGACAGtgaggcgacgacggaggGCAGCAGCGGACGAGGTAAGAAGGCCCCGAAGAGTCTTGGCACTCAATTCAAG
ACGTCGCTGGCGCAACTGATGGATAACATCAAGACCACCAACACGCACTATGTGCGTTGCATCAAGCCGAACTCAAACAAAAGTCCGACGGAGTTCAACA
AGCGCATGATCGTGGAGCAGTTGCGGTCGGCCGGTGTGATCGAAGCCATTCGCATCACGCGCTCTGGTTACCCGAGTCGTCTGACCccgaaggagctggc
cacgcgCTATGCCATTATGTTCCCACCGTCGATGCACAGCAAGGACGATCGCCGCACGTGCAGCGTTTTCATGACGTCAATCGGGCGCAAGTCGCCGCTG
GAGTATCAAATGGGTAAGACGCTTATCTACTTCAAGAACGGAGTtatggaagagctggaggcaaTGAAGTCCGACTTCATGTACTACGAAGCGCGCACCA
TCCAGCGTACTGTGCTGGGTTTCTTGGAGCGCCGCCGGCTGCGCAACAAGATCCGTGCGGCCATCGTGCTGCAGTCTTACTCGCGGATGTCATTGGAATA
CAAGGAGTATCACTTCCAGCGTCGTGAGATCATAAAGATTCAGCGTGGCTGGAAGAGGTACAAGTCTATCCCAGTAGAGCCCGAATACAACGATTCcgag
gacgagttcaacgGCGGCGGTCAGTGGGTGGACGAGCTCGATGATCTCGACGATTCGGATGCCGACGAGGGCTTTGGCGACGACCCGGCCTCGGTTCGTA
CAGGACGTGGCAGGTCAATCGCGGATCGCATGGAGTCGTTCAAGGTCGCTCACTCGGGCCGCCGCGGCAGCGTGAAGCGTCTCAACGAGTTGTCTGCTCG
CGCcaagagcttcatgaagccgcgcagcggcagcggcagcacaTCGAGCTCGAGCGGCATCTCTCTGGAGGATGAGAACtcgatgctgaagatcgaGAAC
CGCAACCTGAAGTACGATCTGGAACTGATGCGCGAGCAATGCATTGAGCTGCAGGCCATCATCCTCGAGATCAACAAGAGCCGCAAGAGGTAGAAGAGGC
GATGGTGTGACGTCGGGTGCAGCTCTACCCGTGCTGTGTTCTCAGCAAACTCAAGgccgcagcaagaagacagCAGTTTTTAAGTAAACGCCGCAAGGCG
TATATCTGTAGCGAAAGAAGACATGACAATTTTTTTCTCTTTCAACATGTGAAGACGTCGAGTACATTAGTGTTCACTTTGCATCATTCGTTGCCATTAT
TTATCGGGTCTTGACTGAAATCGTGGGAGAGGACACCGTGTTCAGTGTGGGTATCTAAAGCGTTGGTCCATCAGCCAGATGCTTTCATTCTTTCGATGTG
AGTCACGGAGGACTTGAGTGGCTCCAGGCATCATCCCCATCGGAGTTTCGTGCGCACTTTGCCTTGCTATAGGGCGGAAGATCGAGTTTTCGAAGCGAGG
CTGccagagcgagagcgagagcggcATTGCCGATCAGTCGGCGTAGATGGCATTACTGATGCCCGACATCAACCTCCGTCGCGCAAAATGCCACCTCGAG
GTTTGTCTGGCAAATTCATCGTTTCATCCATCACGTCCGGAAGCTGACGTTCTCATTCTTGTCTTGCGTGACGTTGGCCTGTATTGTCTCCGTAGCGCTA
CTGGCGCCAACTGCTAGGcggagatcgaccaggagAACGCAGGCGCTTGATTTTTCGATCCAAGTCCGTTGCACAGGCTAAAGCGGGCCAAGCAGCACCT
GAGAATGCCAACCCTACAGCTACTGCAATCAATTCCGTCGAGGTAGCTCCACCGATTCAAAATCTAGAGTCCGACTCGAAAATGGAGGAACCCACTGGCG
GCATCGACGCGCTTGTCGATGATTCTGATGAAAAGCCCGAAGTCGAACTTGATTGTGGATCTTCATCAGTGGTGAAAAGCACGAGTTGCAACCAGAAGAC
GGAGACTCGAGCTGATGACAGCCGCCAAGAGAACAACAAGGAACAGCACGAGGACCTGAATCAAATTCCTGCTATCGAAGATGCTACTGGAGGTGACAAG
CCAGAGTGCAACCAACCTGCTAGCTCGGAAAACGCTAAGGAATACCCCAAGGCAGATTCGGAACAAGCTCCTTCCTCTACAAGCACAACTGGAACATCTT
CGTCAGTGGGCTCAGTTTTGTCCGCTGAAAGAACAACCAGTTGTGCCGGTAAGCCACCACTAAACCGCTCAACTGAGAAGATGACACCATCGAAGTACAT
TTCGCGGGTTCAAGGTTAGTTGTAGTGAACTATGTTGTGCTCATTGGGTAGATGCTTACATGTCGTCTTGTATGGTTCGTGCAATTGGTAGGTCCAACAC
TTGGTTCTATCTTGCAGCGTATTCACCTCAACGACGGAGATGTGAGTGAGCTCGACTTCTCGACTCTCGCTCAGCGCAACAAGCGGTTAGGGTCTGAAGG
GTGTGCTCTCGTGGCACGCTCTCTGTCGACTAACCACACTGTTCGGAAGCTCATTATTCGGGACCACGCTATCGGGGACGACGGTGCCATCGCTCTCGCA
AAAATGCTGTGCAACAACACGACTCTGACGTACTTGGATCTATACGGGAACAATATCAGTGACcgaggagctgaagcacTAGCGCAGGCACTGTATGGAC
ATGACTCACTGACGCATTTGTGGCTGAGGAGCAACTTGATAACTGATCGTGGCGCTGAGGCTCTAGCTCAGGCTATCCGTTGCAACTGCATGCTCAAGTC
TCTGGAACTGGTTCACAACCGAATCACGCGAGTGGGAGCCCAGGTTCTACTTGACGCATTAGATGTCAACTTTCATTTGGAGGTCGTAAATCTGGATGCA
AACGATGTGCCAACATTCGTCGGAAGCCAACTTGCTGCGGCATTAGCACGCAACCGTGCCGAGTCGTTGATACTTGAGTCGCATGCTgcagagaagaagg
ccgagaAAATTGTGCGCAGGGCCAGCGGCTTGGATAtccaagacgaagatgaggacagcagcgagatggaggaggaggactgggaggatgacgacggtga
TAGCGTGTCAAGTGGGTTTCTGAGCTGTTCTGGTATGACGGACATTCCgttgagcagcagtggtcTATGGATTTAGAAGCGCAGCTACTGCATCAACCTG
TGCTTTTTAGTACGACATTAGGGAGGAGCACACAAACATAATAAACTCCTCTTGAAACAAAACGGATGTGGAGTTATGCCGTCCTAGAAATGATGCACTC
CGGTCACCCATGCCGCGGatcagcagaagaagtttgCGATGTAGATACGTCAACGACCAGTTATACTTCATGGTAAGGTTACTCGAGGTCCGCTGACTTC
CTCCACTCTGTCGGCCCGAAATTGATGCGGCAGCAATCCTTTGACTGCTTGGTCAGGTTCCAGAGATAATTATCTTCTAGAAAGAGTATAAAACCCAAGC
TGTTTCAGGAACTCGTCACACCACTCGTTCCTCTCTGTCGGCTACTGTCTCTGATCGATCTCGTGTATGACAGGCTCGAGCTTGCAACTGCGGCTACGGG
ACCTAGTTTGGCTTTCCAAATTGCTAGGTCCCGGAGAAAAATATATGCTAGATGGCCACAGCGTGCAGACTTTGCCAGTAAGTCAGTCAACCGTAAAGAA
TTAAATGGTCTTCCAGAGCTTCTGACGTTGGGCACTTTGAGTGCTTTAAAAAGCTACGCACGCTGGCCCCTGTAGCGACAAACATCGATTCACCGTTCGT
ATCGTCGCCGCAGAGTCTTGAACCGCAAACAGCACCCTTGAATCCGTAAAAATGTCGTAATTGGATCGGACTTGCTTTCATGGAAAGCATTTATCGCTAG
CCTCGGAAGAAGACTTGAGTGATGTCACTATATGGCGTCTCGATCCACGGCGAACCCGGCTCCAATGCACCAATGAACTTCTATGAGACGGCCGCTAACA
GCAGGCAACGTCACTCCAACCTGATAATCTTGTTGGAACAGCAAGCCCAGGAAGGAGACTGTCGTGGTTACTAAGCACGGCCATTTTTCAACTGCTGCCT
GCGCCTCAAAAACTTTCACGAGGGCGCTGTCTTCTTCCACGATGCTGGTCACCTTGGAACGGCGAGACTGCCGAAACTCCACCATCACATGAGCTGAATT
GCTCTTCATGTCCGCCAGACGTTGTACCACCGCAGCCTTCCCGAAATACAGGAAGTACTCTCCCTTGGTCCGTCGCATCTCGCCACAGCGAACTGCTTGA