Description :
From Genome Similarity Track
Location :
Scaffold_37:93316- 103724
Transcript NameFunction/comments
Phyke_g2214dynein heavy chain
Phyke_g2215hypothetical protein PHYSODRAFT_293856

Sequence
10408 bases(100 bases per row)
TGTAATAAACCATGCAAAGCTTCATTGACAGGGGTTAACGATCCTCTCGGTAGCACTGTGCCCACTACAATAGACCACTTGAAGTGCTTCTAAAGAGCAT
CAGTCTGTGTGTTGCCGCCACCTGCCCTCACCTGCTGCGCCAATCTTTCCGTTTCTGAAGACAAGAATACACATCATAAGTTAGCCATGAAGACCTTCTC
TCCATAATGCGTAGACAACACTCACCAGACTTcctctttgctgctgcgacggcAAGAGCAACGAAGACCACAACCATCACACCCAGGAACGCACCAACAC
CCAAGAAAATGGTCTTTGGAGCGGACGCCGAGCTGCTCAGCGTTGCACACGAGGTGATATCCTTAACGCTGCAGTCACTGCCAGTGTAGCAAgacaagca
gctgcacgacATCGTGCCGTTCGACTCTTTGCATTGACCGTTTCCACCGCAGTCCGATGTGCTCTCACAAGTACCACCGCCGCTCGTCACCTCGTACGAT
CCGCAAATTTTCTCTTGCGTCGTGCCGATGGCGTCACTGATCTTCACATCACACGTATCACCGCTATCCGTACAGACTACGCCTTCACGACTCGAGCAAG
TCCACGAATCTGTCTTCTCGAGCTTCAGGTAATCCGATGAGCAGCTACTCACAACCCAGCCGTGCTCGGTTGCCAGTTTGTTGGACGACTGTGCCTTGGT
CGCAAGGGTGGGAGCCCATGTGCACTTGGTCGTATCAGTCCAGTCGGCCGGGTCCGAGTATGCACTGTATTTTGCGAATTGGGCCTTTAGGTTTGTGTAG
TCTGTTGTAGACTTCGAACTTGGTGTTCCTAGGAAATCCGTGTCACCACCTGCAAGCGAAAAACGAGTTTAACTCTTTCAAACTCAATCAAAGCATAATA
TACGAAGAATTGTACCTGTGAACATCGGGAAAAGCGAGTCTGTCGCAAGCTTAGCTTCACCGTACGAGTATGCCAGTCCGCCAGACCAAACTTCAGTGAA
TTCTTTCGTCTTCGAAGGTTCCTGGTACATGTACGGGATCATCCCCCAGTCACGGGGCGCTGCCGAAGTAGTCTTGCAGCCGTATTCACCaaaagcgacg
acgatagGGATACCCTGAGCCATTGTAATGTAGCGCTGGTAGGCCTCCGCGAACGTCGAGTCGGGGCACCAACGATATTCGTTGATCAGGTAAATATCGA
TACTTTCAAGCATCATACCCTTCGACATTTTGTCGCCGCAGAGAAGTCCCATGACCTTGACCACGTGGTAGTCATCAGCGTCTGCAAGCACGTCGTTACT
GCTATCAGCAGCGGCGTAAGCAAGCGGCAGAAGgcgcagcttcttgccattCACCGTCATCCAGTTCTTCAGGTCAGACACGTACGCCTTCACACAAGAG
GCAGCTGTGAGATCAGCCTGCATGATTTCGTTGGCCACGACGACTCCCAAAGTGTTATCATACTGTGCAAAGTTTTGAATAATCTTCTTGCCGTACTCCA
GAAGCAGGGCTGGGTAGCACGTCTCTGTCTGGTCCACGGTCTTCGCGCCTGATTTGGACGACACAGCTCCAGAGCAactgagcttcttggtgatggTTGA
GTACCGGTACTTCCCGTAGTACTCATCGTTATCGGGAGAGGCGGACACCAGAACGTACACTCCGAGCTTCGCCATATCATTCATAAATTTCTTGTACGAG
GACGTCGGGTTGATGTTGTACAGACGCAGAGTGTTGTAGTCCAGACCCGATAAATGCTCCGAGATGGCCGCCTTCGAGTACTTGTCGTAGTAGTCGTCGC
TCACAGCGTACTCGTACGTCAGCTATTCAACCATTAAGGCACGTAGAATAGTAGCGAGTTAATTCGTCATATAATGGAGCTCCATGTACGATAAAGGCAA
TCCTTCctatcttttttttttactgtaCGTACTCCCTTAATGAAGAACCGCTCGCCCGTTTTCTCGTTGTACATTTTGTTGCCGCGCACGATGATCACTC
CGTCCACGGCGGTCGACGCCATTGTCGACTCCAGCATCGCGACCAAGAAGGCCAGCACGGCCAGCAGCATTCCGCTCCGTCCAGTCATCGTAGCGATCCG
CCAACCAGTCCGTCGCTGTAGGCTCAGCTCGGTGTTTCACTATTGAGCCGTTCGAACCGCCTCTTCCCTTTTTTCCCCCTCAGTCGGACAGAATAATTTA
GAGCGGATTTTTACACCGGCTGGTGCACCCACAAAGGGAAAACGAGCCTATTATACTCGGTATTTGAATGCAATTGCAGCTAGTCTAAAACGATACTAAA
TTTAACAAATCAGCGCGTTTTATTGATATGCCAATTGATGCGTCGGGAGCTTCCAATTGGACGAAATCACGCACGCAATAACCTACCCCGATAGATAATG
ATTTGTCAAAACATCAGATTTTCACTGAATATTCTGAAcccattttgctgcttgaagtgAGCGATATATTCGTTGCTCTGTAGCAATTGCCTCCTCTACC
TCACtggtgacgatggcagaAGTGGGCGAGACGAGTGTAAGCGTCCTCCAGCACTTCATGCGGCGCGGAAAACACAATACGGAAGTAGTTGGTCATCCCG
AAGCACTGCACACAATGCAAGATAGAGAGTTAGTGTCACCAACACTACTGTAATAGGCCTCTGTAGCAAGCGCACCTGGCCGGGCAACACGAAGACCGAC
TCCTCATCTAGCAGCTTCTGcgtgaagtcgaagtcgtccTTGATCTTCGTCATAATGTGGGTCTGGACTTTCACCTGCGAGCATAAGCGCGTTGCATCAA
TCGTAAGTTATCGCAGCAGTACCCACAAGCTTGGGTGTAAACAGTGACGTACCATCGCATACATGGCGCCCTGTGGAACCACCACTTCCAGACCAGGGAT
TCTCAAGAGCGTATCAATAGTGAATTTAGCGTTGTCCTCCAGAGTTGTGAAGTATTGCTTCTTGAACATCGCAAGCGATTGCTCCTCCGCGCTTCCCGGA
ATCGGCGTGAGTAAGTCAGGAATCACACTCTGTTGCAGCAGTCACAACGACAATATCGACAAAATTAGTTTACTTCCATCCTGGTGTACACTTGCTGAAT
CGGTCTGGTTTATTTACCTGCACGAGCGAATTTGCGCCAAGGATATTTTGCGACAGCTTGAAGTATGCGGTTCGGACGCCCTTCAAGATATCGTTGCGGT
CGTGCACCATGATCCAACCCACTCTCCAGCCAGGAATAAGGAACTGCTTGGCCAACCCGCCGACAGCAATCACGGGAACAGTCTTTGTCAGGGTCGCCAT
GGGATAAAACACATTGCTTCCAAACACCATGTCGCCGTAGATTTCATCCTAATTTCAATCAAATACAAAGGTAGACAAGTTAGCTAGCGCTCTGACAGTA
CGCAGCACCTCAGATAAAAGATAAAAATTACCGCGATGATAGGGAGCTTGTTTAACTCCGCCAAAGCAAGAATTTGCTTTAAGTGAGGCtacgacaacag
caacaagaggtaagagagagagaacaaACTGATAGGCAATTGTCAAAGCCAACGCTCACCATCGAATAGACACTGCCGCATGGATTGGACGGGTTATTCA
CCAGGATGGCCTTAGTGTTTCCGTCCACCAAGGACTGCATGTGTTCCAAATCAGCCTCCCAGTTGCATTCCGGCTGCATCAATTACACGAGCAAAGGGCA
AACAAGTAGATTCGTCAGAAAATGACTGCTCTGGAAATGTTCCGCGTGGAAAGCTCACCTTCAGATTGTAAAATCTGCACTGGATCTTGTGAGCTTCACA
AACCGCTTGGTACAGTGGGAACGCTGGTTTGGGGAGCAGAATGTTGTCGCCAGGGTTCAACAGACCTTGAAGTGCAATCTCGATAGCACCCGAGCAACCA
CTGGCGATAATGATATCGTCCATTGTTAATGGGGCTCTCAAATTGCCGTAGTGCTgagcaattgctgcacgagCGGTCTCAGATCCGGCCGAGTGAATAT
AGCCGTTGTGCTTCATTGAGCTGCATGTATCAGGCACAAAAATAATTGGGTCAGCTTTTTCTATCACCAAAGAGGTCAGCAACCATAGTTTCAACTGACC
GAGTATTGCGGACAATTGCCTGCGCCAGAACATCAGGGCAGTGAAGGTTGCCAAACACCGTGGGGTCACCTGTCAAATTCCAGTAAAAGTTAGTTAACCG
AGCCAAGTTCACCTTTTCAACGTGAACATCATTGCCAGGCACCAACCGAGTGATAGCGGGATGAGGGTCTTTGACGACGTAGCGggcttcttgatgttgt
ctACAATCTTCCGGATGGGATTCGAGCACAGTTTCGAGAACTCAGACGGTTGAACATTCCACTCTTTTTGGGGTGTAGCTTGAGGATTGGCTTGCATCAT
TGTGGCATCAGAATCGAACATGGcggtggtgatgctggagttTCACGCTGGTGGTTGATTGACAAATGATGGCAATGAGGACATCCGATCCTGGTCATAA
GACGTCGATCGCCATTTGAGCATTCCGCCGCTGCGTACAATCGAGTAGTTTAGACGCCGTTGAATTTGACCTCCCCTAACCGCCGTACAATTCCATCGTC
ATGCTGCTCGACGTGCTTTGCTCATGCCTAGGAATTTCGTACCAGCcgtgttgaagcagatgTGTTCAAGTTGCAGTCGTTACTGTCGGTAACTTACTGA
CCAAACAATCGGTACACCTCCGCAGCGCAGTTTTGTCGGAACTGCTCTTGCTTGAACACGAGTTGCCCCCTTATcgtttcttcatcgtcccCGAGAGCGC
CAAGCACGACACCAAGAAAATCTTCTTTCAAGTCACCGTCTTCCCAGCTCTTAGTCAACACCGCTACCATATCAACGCTAGCGTTTGCAAGCAATTCGCG
CCactctgcagcttgagtTTCTGCCAGATGCCGCTGCGTCTTTACGAACATTTCGCTATCGAGGGACAGCAAAATCTGCTCACGGTCACGTTGGTTTATC
GCTCCTAGAAAAGCAGATACAGCAGCGCTTTCATCTTGCAGTGTAGCAACTCGCGGTGACGCGGAATGCGACGCAAGTAGACGCACCTCACACTGCTGTT
TGATCAGCTCTTCCAAGAGAACCCGGGCGTAGTACGGCATTAAGCGTCGGTCTGcaacgagctgctcgcgGACACCATCCCACCAGTAGTTAACAGCAAT
AGTAAACTCGTCCGAGTCCACTTGGTGCCACCAACCTTCTGGGATGAAAAGTGCGTCTACAGCAACGGCATGGTCACGATGGCATTAGTTGTCAAGTGAG
CAATAGTCTCGATCGCGAAACAAGTGCACTAACCTCCAGCTGCAATTGTAAACCTCTGGGCCGAGGTCTCGGTAAACCTTGGATATTCTGAGAGGTTGGG
CTCGACGATATTGACCCGGCTGTGGTTTGCCGACTTTGTGTGTACGGGGAACGGATACAATTTGGCGCTGTCAGATGGAGGATACAGCGTGACAGTCTTC
TTTCCGTATAGCACCACCAATATGTTTTGGTACGCGTCGTAATGCAGAGTAGTTCGACTTGGCTGCACAGTCATCCACAAATTAACTTGCGTCAAAGGTT
TGTCTTGGAGGCACTTTGGTCTAAACAACGGCAAACAGTCACGGGTCAGACTCGCTACAGTACGAGCAACATTGCAACGACAAATGCACTTACAAGCAGA
ACTCATTCATGATAGATGGCAAAGTCGCCTTGGTGCAAGTAGTATCAGGCTTGTACACTGCAATGGGGCATTGGCACAGATAAAACTCCAAGTCGTCCAC
AGTTTGCAACCAATGCGATTGGTTCGTGAACGAGGCTTGGAAGTAATCTACAAAATCACCGAACTTCAATTCCACACTCTGTCGCTCCTTGTCGGTGCCG
CAGTAGCAACCACTCGAGCGCTCTTTGCATGCTATATCAACCACTGCAACACCAGAGCCGTCAATTCTGCAGTCATTCACAATAAACCCACCACATAACG
TTCTCACCAGTGCTTCGATGCGACACAAAGGGCTCCAGGAGGTGCACTGAGTGTGGGGTAAACTTAGACAAGCTGTCCGCGCGTACACACTCAGTAGCAA
AGCCTACGTAGAGGACCGGATCGTTCATGCCGCCCAACTCCATCGTTTTCTAGTAAGACAAAAAAGTGTCGGTATACCGGTGTCAATATGACTttgcaca
cgtcacagacgCAGGTGTGGTGACACAAACGTTTGTGGTTGACTTCAATGAAAGTAAAAGACTTTATCAGTGGAAAGAGTGCTGGAATCTTGTATGATAG
AGCCCTTGTATTCATTTCTTCTCATAGCTACGTGCTATGGTGTGTCCTACTATATGATAGTTACTAGATTGCTAGCTCGTCATTTGGCTGGCGTGCTGCT
CCACCAATTTGGCAACCGGAGCAACAACAGGTTCCAGTACTGGATCGTTTGACGCGACCTTACCAACTGTAGCGGCTTTCGAGTGGCGAACACAATAACC
ATGGCGCTGAGCCCACTTTTGACAGCCTTGCTCAGCACAGCGCGAGCCGCCGCCGTGAGCGCGGCAAAAGCCCTTAGAAATGGCCCCCTTCGTGCAGCCA
GGATGCTGACACCGCACGCCCCCACCGTGCGTCTTGCAACAGCCACGGGATTGCACAGCCCGTTTGCAACCCTCCACACTGCAGTATTTGACACCACCGT
GCGCGCTGCACTTGTGGCCAAACTGCGCCACGCGTTCGCAGCCATTCTCCGCACACAGTCGTCGCCCACCATGCCCAGAGCAAGCATTATTAAAGCGTGC
AAACTTGTTGCAACCTTCCACTTCACATCGCCGCCGCCGGTATCGCTTGGCGACTGTCGTTGATTCTTCAGTCGCGCCCCTTCCCGTATCAACAGCGGCG
ACCGTTAAGCCTTcagacgatggcgatggtgcagtTTCTTTGGCCCGATCCACTGTCTTCTCGATGTCTTGATCATCTTTGCTTGTATTGCTTTTTGGTG
CAGACACTGCAGTCGTCtctggagcaacagcagcagcagctgtcTGCTCGGTTTGTGACTGTGGTTGAGTCTTCTGCTCCCCTTTTGCAATCACAGCGGC
CTTGAGTAGCGTGTCGATCCACTCGCGCACAGGATGCGCCTGTTCATCCGTTGTAGAACTTGAGTCGTCCGTCTTGGGAGGCTGGCTGGCCACCTCGCTC
ATCGTCGTCCGCGCACTTGCTCCAGCGATCTCTCTTGTGTCACCCGTCACAGGGACTGGCGGTTTCGTCTTCGTTAAAGTATTGGTCTTGATTTACCTTG
ATTTCACTATCAGCTCAGGAATGGATGGAGCGCACCACGTCGCAGATCAgcatttcaaccaatcctCTTACTTAAAGTGCTGTAAAAGTTTACGATTGGC
TGAAAGCACCTCACTCGTTGAAGTGACCCAAATGCCGGCTTCAACGTTTGTTGGACCCTTCCGCCGTGAcaacaccaccaacgccGACGAAGGTATACAG
CCATGGGAGTGCTCAATCTGCTCGACGACCAATGAAATCAGTGATGAAGTCTCTCCAGCGCGTTGCCAGGTATGCCAACGCCTTCGTAATCCGCAATGGC
TGTACCTGGGGGAATGGGAATGTCAGGTACGATTCAAACCAAGTTTCTCAAGTCGGCAAGTTATCCACACTAAGACACTGTCGTTAAAAGATCTGCTTAG
GCTCCCGGGTCTGGCATACTAGTCCAGGAGGCTCCAAGTTTGTCTCCATCGTTGTTGCCATTAACTTCGTCCAGAAACTCGTAACCTTACTGCGGGTGAA
AGTCAAAGGTGCAGAATTCAAAAGTGGGGGCCAAAATGCTGCAACAAGTTTCCACGTGATTGTGCTTAACGCGCTACAAGTCCAAGAGCAACTTATACCT
TTGGatgctgaggaagaagctgacaGTTTACTTGATAAGTATGGCATCTGTGGAGCTTGTCGCGGCGTTTATCGCATCGAACAGGGCGACATTCAATCGC
AATATGCGAACGAAGATAAGATTGCTGTCCTTCTGAACGAAATTGGACGACTAAGCGAGCAAAAGCTACGATTTGTGCGAGAAAAGGCATACGAGCGGGT
GGTGGAATGTTCAGAAGAGATCAAGTGCACGATgaaacagcttcaagtcGCGAAGCGTGAGCTCGAATTCCTCAACCCCATGTTCTGTCCATTTTGCGGG
TGGTTCCCACCAAATGAATGAATGAAAAGACCAACGCATAGGATTGGTACAACAAAATTATGTTTACCTAGTTTTAAATACTCAACGAGAATGTTCGTTC
CTTCTGTCGGTGTCGAAAGTAGAGTAACAGCGTCATCCGGTATTTCCAGTTGGGTCAACTCCGTTGGTCGTAGCACTGGCGAAAGATCGTGGTGCTTCTC
AGATAACAGCTCTAAGCTTTTAAAATTCGGGGCAATGAGAATTACATGACTGAACAGCCAAACCAGGACTCTTCCGATTCAGCCGCAGCCGATCCCTCCA
CCTGATTGTCCAAATTCTTCATAGCAGACGCGATATGCGTAGCAAAGTATGGATGCCATACGTGGTCATACAGGAACCGCGCGGTAAATGGGAGATCGTC
CTTATACGCTTTGGTGACCTTGGTACCACCCCACACACGGCTCCGCTCCACGATCCATGGTATCATGATACGCTTGGGTCTGGTCGCACGAAAGACACGT
GGCATTACATAGCGCTGGAAAGCGCTTTCCGAAAATGCGAGTTCAATTGCTGGCTTGAAagcctcttcttcgagcgcCAGCACATTGAATAGCAGGTGAT
TGAGTCGGCGGATGTCATCCTGCAGAATTGTTAAGCGGTTCTGCCAAGACTCGGCGGACGTAGCAGAAAACACCAGTCCGTCTTCTTGGGCGACAATCAC
GTCCATCAAAGCATATACACCTTCGTAGAAAGCCACGACATCGCGTTTGTCGACAAATTTGATGGCGACAAGCGGGAGGAGTACCTTCGTCTTCACGTCG
TGCTGGTTCTTTACAAACTCGATGAAATACTGCTTGAACCAGCTGAAGAATTCCCTCACGTTCCAGCTCATCGGTGACTCCAAATCACGGCTACGCTCGA
GGAAGCGATCAATGACGTATAGTGCATGACGAACGGGTTCGTGTAACCCCAGGAGAAACTGTGAGTTCCAGCTCatgtcaacttcatcgttGCGCGTTAA
CACTGTTGAGAACACGACATTTTCACCTTTGTACTGTGGTCTCGACACTGGAGCACTCGTCACGTTAGTGAAATCGTCAACTGATAGTTCTCTCCGGAGT
ACATTGGTATCCATTCTCAATGGACCGAGGCTCAGAACGCTGGATGTTACTGATGACGATCCATATTCACTTTCGTGCTCCGAAATAGCTACCGACAGGT
TACTTGCATATCGCTGCGTTTGACTCAACTTTGCGCAATTggtgcgttgctgctgctgtcgttgctgttgcagttgcaatTGTTGAGACTCAAAACTGCC
CCAAATATTGAAAAACTCCGTGGTTGGTGCGGTTTCATACCCGCTCTTGTAGTCGATTGTCGTCAGCACATGTGCCACCTGGCTAATATCCACAAGCGGT
TGAGACTTCTTGGTCGTAGACTTCTTCGCATGTGTGGTTTCAGGTGGCGACCAGATATTTGAATAGAAGACGGTctcatcgccaagaaggcgacgcGATT
TCTTGACGCGCTCGCTCTTGGCAACCATGGACAATCGGCTTCTCTCGAGAGGTTTCCGTTTGACAGCGACCGGCCTCATGACCAGGCTGCGAGGCAGCAC
TGGATTGTCTCGGTGTACGGGCTTTTCCGATTGGCACTCTCTGCCAGGTATCGGCAACTTGCTTAGTTCGATGGGCATTGATCACACCTTTTTTTCTTGT
CTCTTGTTGCACTTCTTTCTCTCCCTCCGTTCTTCACTTCAGATCTCTACCCCAACCAGATGCCACACAAGTAGCTAGATCGGACGGCGATATACTGGGT
CTCTTTCTTCCTGCTGTCGTTTGTGCGACTGCAGTTGTCAAAGCCAGTGACCAAATAGACAGATGGAGGCAGACACAAAGTGAGAAAACATGATGCCAAC
AGCCGCATGTTGTCAAAATCGTAAAACCATCAAACCACTAACCTGTCTCGACAACCACAGCCACACGACGTAACGCCGGTTTCGCTCTTGACAATCAGGT
CGAGAATAGCAAAGTGAGTGAATCAAAAAGTGAAAATATTCGGCTGGTTGCGGCAGAGAGACCTAATGCGGGTTTCGGGGTTACACACTCGAGGGTGTGG
AGTCCATTGTGGACTCCGTCACTCAAGACTAGAGTAAACTACCCGGCCAGCTGGAGGAAACCTGCCATGTCTCGACTTCCAGAGAACGGCCAAGACGCAG
GGCGGACG