Description :
From Genome Similarity Track
Location :
Scaffold_80:9329- 24805
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_80-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_80-fgenesh-gene-0.3Polymorphic outer membrane protein
Pytar_ATCC12531maker-par_contig_80-snap-gene-0.9Titin

Sequence
15476 bases(100 bases per row)
CGTGCAGGAAAAAGCCGAGTCCGACCGCGACGACGACCGCCGCCGGCAAGAGCGGTTCGAGGAATCCGTGGCCGGCTCCACGGCGCTAGTCGACGTGCTG
CTGCGCAAGAACGGGTACCCGAACGAACTGTTTTCTCCGGCCACGTCGCGTGGCAACACGATGCTGTCGCTGCACCACCAGAGCCGCCACACGTTCTACC
TCGTGCCCAAGAAGTGGCTCATCAAGTGGCGAAAGTATGCGCGCAGCCTCGCGGACGACCTGCCCGGCCCCATCTTGAACGCCGAGCTGGTCTGCGACAC
GCACCAGCGCTCCATCGTGCCGGCGTACATCACCATGTTTCTCTCGGGCTTTTCACTCGAGGTGTCGCTCCAGGCGACGCAGGCGTGGGTTTCTCTTCTC
TATGGGCTCTGCGTTTTGATGTTGAAGTGATCTCACCGTGTTCTATTGTTGTGGCTGACTTCATAGACTTGGTGCGAGTGCGGCGACGCAGTACGAGATC
GTCACGGACAGTGAGTGGGAGGCGCTCTTTGATCGGTACTGCGCCGAGTACGCCGTGGGCTTTGACGTCCACACGGGATCCTACCACTGGCGGACGCCCG
AGTGCCACATCTGTCACTACGGCATGGGCGGCGGCAGTCGCCGGGAGCGACGTAATCCGTCCCGACGCTGAACAAAGGCACACCTCCGACGGAAACACAG
GAAACTAGTTTGCACAAAATGCATGGAATGGACAAACCCTATTTCCACCTACTCTTCCTTGTTCGCCTCGCTCTCTACTTCCGCAAGCTCGGGCAGCCGC
GTTTCACTACGCAGCGACGCGAGTCGTTCGCGCTGGCGGACGAGCTCGTATGGGTCTGAGGTGAGCGTGTCCAGGCGCAGGCGGCGGAACGCCTCGAGCA
CGGCCGGCACGCTGAACTTGTCAAACCGCAGCTGGCCATACTTGTCCATTTGGCCCTCGTAGCACGCGTAATTGAACGCGCGTCGCCAGCGGTGGAGGAC
TTCGAGTTGGATGCGCCGCTTGCGGGCGGCCTTGTCGGCGACAAAGAGGCGGCGCGACTCGTTGATGCCGTCGCGGAAGATCATGCCGACGCCAAAGATC
GTCACGGCGACACACGTGCCAACGAGCAAGACGCTGAGCAGCTGCTGGTTGATCATCGACTCCTGGTTGAGACTGTTGAGCTGGATCATGACGCCGAGCC
AGAGCGTAAGAAAGAGCTGGAGCTGCGTGACGCTCGCTATGAGATTGTCAGAAAAGTCGCCGTACGGCTGGAAGTAGAGCAGAAACCACATTGTGACGAG
GCACACGGTGATGGCCAGCAGCACTTGCTCGACGCTGCCGTTCTTGACAAAGACAATGACGCCGCTGAGGAAAAGCTTGCGTGAGAGATCGATGACCTCG
AACCACCAATACTGCTGCGAGTCTACAGACAGACGAGAAAAGACACAGATTAGCTATAAGCACGGGTCTCGATCGCTCACAGAGTTGCAACACCCACAGT
CGGCATAGATGAAACCCAGCCGAGCCTCCACCGTCGAGTCGGTGAGGTTCTTGTAGCGCATGTACTTGGCGAGCTCCTCGTTCTGGACGTCGAGACTGTC
CATCTCGGCAACGACGAGTCCGCGCTCTTCGTGGAACGCACGCATTTCATTGAGCCACTTGACGCGGAGCGCACGGCACTGCGGTTTTTGCAAGAGCTTG
ACACGCGCGCGCACGCCGCGGTCCTGCGCAAGTCGAATCAGCAGCCAAAAGAAGAACGGGATGCCGACAACCCACACACCCACGCCAATCATCGCGAGCA
CGCCAAAGACGGCCCATGACGAATCGTAGCATATCAAGCGGCGGTCCACGACCATGTAAAAGACCGAGCCAATCTCCTGGCAGTTGAAGATCGTCAAAAT
GGTCTTGGACACGGTCGGGTACAGAAAGAGCGCGAGCCAGCAGTAGAGCTTGAGGCACTTGTTGCGGTACGTGAGGTAGTTCATGCGCAGCTTGACACGC
GCCTGCCACACGCGCAAATTGCTTCGGATCGTCCGCTCGATCATCGCACCCGAGAGCCGGTGGCTTGTCGGACACTGGGTATGCACCGACCGGAAGATGC
CGAGGTGCGGGGTCTTGACCTGAGACATGCCAAACTCGCGCTTGAATCGCCTCAACTCGTCGTGGGCACTCTTGACGTTGCTCGCACTTGGCGCACGCGA
CAGTCGGCTACCATGGGGCTCCGTGGGGCTCAATGCAGCGGCTGCGTTTTTGCCTTGCTGCTTGGCCTGCTGCCGATCGCGCCACCAGAGCTTGGCCATG
ATAAGCGGATTCAAGCTCGCTTGTTCGCTCTCAAATGTCTGGGCCTTATCACTTTCGAGAACGGGCAGCCCGCAGTGCAGGCAGTTGCGCGGGATTAACA
GCAGCTTGGCGCTGTAGCTGCGCATGCCGGCGTAGAAATAGGCCGTGACCACAGTGACCGTAATCCCCACCAAGACGATCGTGACCCTAGAAGGATGAGA
ACCATGGAGCTGTGAGTACGGCCCGTACGTCGGTAGGGAGGAGGCAAGTGTGGGGCTACTCACGTAAAGTCAAAATAAAATGTCTTGGTGATCACGCAGT
CGATGCCCGCGATCGCCACGAGATCCTACGCCGATAAAAAGAGAGAGATGAGCCCATGAGCCGAACACCCTCTGTGATCCACAACCCCCACACGCACCAA
ATTGAACTGCGCTGAAAAGTTCATGAGCCGCTGGACGTCGCCCGACCATTTCACGACAAACGCGTCACGAAAGTTGCCAAAAATCTGGAAAAAGCCGATA
AAGATCTTGAATTTGCCCGCCTTGATCGGGAACGGCCGCGACGGCGGCTCCACGTCAATGCCAAACAGCACGCCAGCCTGGTTCTTTCGGCCGCGGCGAC
GCAGCACCGGCGGCAGCTTGGCGAGCACGGCTTCCTTGGCTCGCTTTAGCAGCTCTTTGAGCTTGGTTTGCACCTGCGTCTTCTTCTGTTCGTACACGCC
CTTGGCGCGCTCGATCACGCTCACGCGTCGAGACTTGTCACTCGGTGGCCGCAGCCTTCGATCAGCCTCGGCCTTTTCGAGCAACGCAATCTCCGTGAGG
TCCCGCAAATAGTACTTCACGGCGTAAATCGCCGAAGCGAGCCCCAAGATGATCAGCACTGGGATGACAAAGTTCTGCCACTGGATCGAGTGCCGCATCT
CGTCGTTCACCTTGTTGCAGGCTACAGCATCCAGAGAAACGGTTAGGAGTCCGCCCGCATATTGCATAAAATCTTTTCACGTACGCAAGCACGAGCCGTC
CTTGGCCTTTTTGAAATTCGTCGCACACACGGAGCAGATCGCCTGGTCGTATCCGTGGCCGCAGGACTCACTCACGGCGCTTCGCGCCGTCGCGACCTCC
AAGGTGACGTCGGCCTCGCACGCGTCCTCGACGTCGCACGTGTAAAACGACTGGTTCGACAGACAGGCAAAGACGCGGTCCGCTGGCCAACTGTCGACAA
AGCGGGGCCCGAGCATTGAACACTGCTGAATAATCTCCGTGACGTTTGTGCCCTTGGGCTGCTTCTCAGCAACGGCTTTGCAGACGTCGGCGTCTCGCCA
TTGCGCGGGATCGCACGAGCGAATCTGCTGAGACGCCGGTGCCGCAAAGAGGTAGTACCCCTGGATCGTCCGCGGCGACGACGTGCCGAACTCTGAAGCC
TTGGTTTCGGTCGCGCGGCGCACGTTCATGCTGCAGTCGGCGCCATTGGGGCAGTCAAAGCACTTGAGTCCGTCGAGACTGTACTTGGTCTTGGCACAGC
GCGCGCAGTTTCTACAAAGCAAAGCATTAAGAGAGATTAATTACCCACAGCATCAAACGCTAGACAATCGTGACGAACCCGCTGTTGGCTGTCGAGTACC
CAGCCGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGTAGCGTAACGTTTTGCGTGAACCGTAGCGTCCTTTTCTCTGGCAGCACGCACGTCAT
ATTGAGAGCGTACGGCAGCGTCTCGCGTGGTTGGCCGCCTTCAAAGGTTGCCGCCACAAACGAGACAATGCCGGCGATCGCAGCGCGTCTCCCCCACGGC
TGAAAGAGCAACTCGCCCCGGATGGCACTTGTAACCGCGCACTCGGTCACCGTGTCCAAGACTTCGATCTGGTTGTACAGATCCACGGCCTGGAGCCGTG
GCCAAATCAGTTTCGTGTCACTGAGACTCTTCTCCGTCGTGTTGATCGGAGTGAACGACTCTTCGTCGCGCGGCTCCATGGTCGCGACACCGCTCGTGAC
GTTCGTAGGCCACCACATGACGGTCACATCGCGCGTGTTGGTCGCTACTTCGTACTTCGTATTGTTGGCCGTGATGCAGTCTGTGCAGGGCACAAAGGTC
GACGTCAGCGTCGTGTTGTACGTCACCCAAAAGAGGCAGCCGCCACTCTTNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCGGCAGTCGATTTCACGAGTA
GTGACGCCCCCAATCGACGCATAGTAAAGAGCACCGCCTCGCGCAGACGCCACATTGTCCGTGAATGTGGACTTTTCGATTCGCGAGGCGAACGTCGCGG
CGACGTGGACCGCGCCACCCAGCGCTGCCGTGTTGGCTTGAAATCCGCACCCGTTGACACGCGCTTGTCCGCTCTCAGTAACGAACACGGCACCGCCGCC
TTGCTGGGCGGCGTTGGAGCGAAATGTCGAATTCGTTAGGTGAACTACACTGCCATCCGCGACTGAGACAGCGCCACCCACGTCGGCGGTGTTCTGCGAA
AAGTTTGCACCGCCCACCACTACGACCGAATCGTCGGATGCCTTGAGGCGAGCAGCAATAGCACCGCCCATGAGATCGGCCGAGTTGGTTGTGAACAAAG
TCTTGCCGCCGATGTACAATCGTGTGGCGCGGTCGGCGAGGATCGCGCCGCCCATGCCCGCCGTGTTGTCGGTAAACACACAGCTTGTAATATTGATACT
TGCATCGACGCCCGTGATGGCGCCGCCGCCTTCGTTCTTGCCCGTCAGCGTCACGCCGCCGTTGCCACGGAAAAGAGAATTGGTGGATTCCAGCACAGCG
TCCCGACTGACAAAGATGCCGCTGCCTTGGCCCTTCGCCTGGTTCTTTTGCACGATCGATTCGTTGAGGACCGCGCGCACTTGGTCGCCCGTGTCCATGT
ACAGTCCGCCGCCCGAGTCGTCGGCGATATTGTCCGTGAGCGTTGAATTCACAAAGTCCAAAGTGCCGCTGTTTTGTATGTACATACCGCCACCAAGGTT
CCGGGATTCTAAGTCCACAGAGCTGTTAGCGCACCACCAGTGCCACCGTCAAAGTAAAACCCGAACGTACCGCTGTGGCCCACGACGCTGCGCTCAAGAT
GCGCGTGCGCAAGATCGTTCACCATCAAACTGCCTCCCGCTTCTGTGGCAAAATTGTACTCTAAGAGTACATCCGTGATGTACAATTGCGACTGCGTGTC
CACGAAAATGCCGCCACCACTTTCCGCGCGGCCGTAGCTCACTTGCGTCGCGCTTAAGACGAGCGTCGTCTCGCTGCTGCCAGCACTGCCGCCGCTANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCACCAATGTAAAAGTGGCCGCCACGCGTACTTTGAGACACGGCAAGCTTGTTGGTTGCAGCTGCGTA
TGTAGTACCGAGGAGTCGGCTGAAACGTGTTGTCCACTCTGGCGTCACCGCTGTCGGGTCGTTGGTCACATTTGAGTCCTGTACCGTGAGGGCCGACTTT
TCTGACACCGCCATTGCCCCTCCAAAGGGTGCCGTGTTCTGCAAAAAGACGCTGTGAGAGATCACGCCAATAGCCTCATCGTGGACCGAGATGCCGCCGC
CGGAGCCTCCGTCTCGCAGGTTCTTTGCTTGATTCTCAACCAGCAGCACGGACGTCGCTGTCAGATTGCCCATAGCCAAGGAGACTGCGCCGCCGTCGTC
TAGCGCCTTGTTGTGATAGAACGCACAGTCGGTCAGCATCAGCACCGGCAAGAACGCCGGTGGACTACCTCCCGTGCTGCTGACACGGTCCACAAAGAGC
GCGCCTCCGCTCGTGGCGGCATTGCCGTCATAGCCCACGTCCGTGACACTGTGGTTCCCGTCGCCAGTGATAAACATGCCGCCGCCCCGGGTTGCCGTGT
TATCTTTTACCAGCAATGACGAGAGCGAGGCCGAGCCGCTGCCTGAGACGAATACGCCGGCGCCGTCGCCGTCCGTCAACACCGCGTTGGTCACAGCAAG
TCCCGTCACAACGCAGCTCGCCGATTCACATTGCACAACCAAGTTGGCGCCGTCCTTGGACGTCGGAACGGAACTCCTCGAGATCGTTGAACGGCTGCCG
ACGTCGCTAGGATCCAGTGCGGTAAAAGTCATGGCGGCGTCCGCATTCGTCGCTCGCACCAAGACGCCACCGGCCGTGACGTCGGCTCCGTTTTGGTCGA
TGACGAGTCGTGAGTGCAGGACGCGACTATCGTCCACCACGATGCCGCCCCCCTTTTGTCGCGCAGTGTTGGACGAGAAAGTCGACGACTCGATCCGGCA
GGATGTGTTCTGCCCAAAGAAAGCGCCGCCGCCAATCTGGCTCGCGACTGAGTTAGAGACGACGATGTTTTGAAGCTGGCACGAGACAGTGCCGATTGCT
GCGATTCCAGCGCCTCGTTGAGCCGCGGCGCTCGAGATCGCCACGTCGCTGACCACGGCGTTTGACCCATCGAGCACAAGACCACCACCGTCAGCGGATG
CCTTGTTACTTGACACCACTGCGCGGGCAGAGCTTGCGCCACTGGCAGCCGCGAGACTGCCGCCCGAGACAAAAGCGCCTCCGCCCGTTTGGGCGTCGCA
GGCATCGATCGTCACGTCATCGTGTTGGACGGACGCGTCGACCACGTAGAGGCCGCCGCCGCGACCCTGAGGAACGGAGCAGGAGCGAATACGCGTGCGC
TGGAGCAGCAGCGTTCCGCCCAATGCCGCCACACCACCACCAGACTCTTTGGCATTGCAACTCTCGATCGTAGCCCCCGCGAGTTGGCTCTTGCCCTTCG
TCGCAACGCCGCCACCTTGAGCCGCCGAATTGTCCCGCAAGGTAAACCCGGTGCTGTCCACAGTTGTCCCATCCAGCCACATCCCGCTGCCAGTGTGGGC
CGTATTTCTTTCCAGTGTGGTCGATGATACTATGATTGAGCTGGCGAAAGCGTAGACACCGCCACCGCTACTTCGACTCCCATCCACTGGGCCCGACGCT
TCGTTCTCGGCGACGTGCAGCGACTTGAGCGTGGCGGCTGTCGCCTTGTACGTGAAGATTCCGGCCCCGGCGGGAGCACGGCATCGCACAATCTCGACCG
CTTCCATGGAGCTCTGTGAGCCTGTGAGGTAGGCGCCACCACCGCCAGTGTCCGAAGCGCAATCTTCAATCCGCGAGCCCGGACCAGTGAGCGAACTCGC
ATCCAAGTAGACGCCACCACCGAACCCAGTGCTAACGTGGCCTTGGACCACCGAGTCTGAGAGCACGATCATGCTTTTGTCGATGGCTGCGAAGCCTCCT
CCTTGGGCCGCTTCACAGCCATCCAGCAACGCCCTAGTGAAGGTCACTGTGGATCGCTTCGCACCAACGCATCCTCCAAGGCTCGCTGCTGACGACCACC
GAACGGTCAGTCCATTCACCGTTGCTGTCGAGTACTCGGCGTACAGACCAGCACCAATTTCTGCACAATACAACCATCACATGAAATGAAACCGTTAGAA
GGCAGAGAATACAACGACCATCAGGCGCATCGTTAACACACCGGCCGAGCACACTCGGACAAAACAACTCGCATCGAAATTGACAGTCCCATCAGTCAGC
AAGAGGATACCGCCGCCGTTGCGTGTTGCCGAATTGAACGTGAGCGTGAGACTCAACGCGTCCATTTTGGCATCTTTTAGGAGAGCAAGGCCGCCACCAT
CGACCGAGGCTTCGTTCGAGTTGACAATGACGGACGCGATGGTTAGCGCCCCTGCTTCGACGGCGATGCCGCCACCCTGGGCCGCAGCGTTGGATCTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGCAGACGCGGTGTTCCATGCGACAAGACTTC
GAGAAGTCGCTGTGATGACCGTCCCACTGGCCGCGTACAGCGCAGCGCCATCAGTCGCCGTATTGGTGCCCACAGTAGACCCGTCCAGCGTGAGCTGGGT
GTTCTTCAAGTAAATGGCCCCACCTCTGATGGCGGCGTTGTCACTGATCCAGAGCCGTGAGGCCAAAACGACCGCGGTTTCGGCGTACAGTGCACCGCCC
TCCGCCGTTGCCACACTGAATGACAGTTCCATGTCAGTCAGTGATACTGCACTGCCGACGACACGAAGCGCTCCACCCTGAGCAGCCACCGCCCGCGAGA
TTGTAAAGGCGGAGAGCGTGACCATCGGGTTCTTTAGAATCATGAGTCCGTTGTAGGTGTCTTGGCAGTCCAGCTTCGTGACCGAGAGACCCAGTAGCCC
ACGGATTGAGACATTGGGAACAGCCACTTGAAGACCACAGTTGTCGGGCCCGACGTAGGTACCAGGATACAGCACAATGGTCTGACCGGTCTTGACCAGT
GCTAGTGCACGACGCAGCGTGTTGAGCGCTTTAGGCGCCTTGCCGCTCGAGTACGTCGTGTCCATCATAGCGCCTGTCCCCTGCACATCGTCGCCAAACG
GACTTACGGCGACCACGTCCTTCGCGTTCTGGAGACAAACTGGGTCACACGTCACGTGCCCACCGTTCACGGTACAGTCATTCAAATCGCGTGGGCAGAT
GACAAGGTTGCTGCAGTCTTCGCCAATGAAGCCACTAAAGCATGCGCAGGATCCTTGACGACACGCACCGTTCGCGCCACACGCTGGTGGACCGGGACAC
GGGATGGTCGTTTGAACGTCCGTGGCGATGGCGGGTTCGTCAATTTCGTATGTAATATCGAGTCCGCTAAAGCTCACGCTCGCGTCCGACGAAAATTCCA
CGGTCAATTGAGCCGTATCCGCGGCCGTGCTCAGCGTGAAAGTGCCTTGGCGTTTGCAGCCTCCACGCCACAACTCTCTGGTTACACCGACCGTGTTGGT
GCAGCTGAACACAACTCGGTCGTGGTCGCATTCGAGCTGGAAAGACGTGATGGTGAGCAGGATCCGCGCGGGCCTCGGCGGCGCGAGCGTCCATGTTTGG
ACAATCGAGTTGGCATAGTTCTTGTAGCGAATGAACCCTCTCGAGCCGCCACACTTGAACTGGTTTGCGCCGTAATCAACCACCACGACACTTGCTTCCT
CGCTCGCATCCGAGACGGTTCCGTCGAGAGTTTCGACTCGGAGTGAGTAAAAGTACGTGGCACCAACTGCCAGATTATTGGTGTCCTCAAAGTACGTGGC
GCTGGTCGCCACCAAGAGGCCAATAGCACTGCCAAGTTGGCGACGGAAGAGACGGTACTTCTTCGCACCTTGCTGAGGAGGCCAATGGAGGGAGACGACG
GCATTTGAAGCTGTGGACACAGACGAAGGAGGAGAGAGATGAGAAGCGAGTTGCGAGTTTCAGACGTATTAGTTAATGCGATCGTACCGCATGCGAGGAG
AGGAGCGGAAGGCTGACCCGCAGTTCGAGACGTCGTGAAGAACACCGCCCGACTAGTATCGCCTTGCATCGAATCGGCCGTGGCTGCGAGCTACAAAACA
AAGTATCAAAGTTTACTTCGAACGCTACATGTTCCAGCCAGTCACCCAATACGAACACTTACAATGGTGACGAAGTAATCCACAAGCGGAGAGAGGCCGG
AAACTACGGTCTGCGTCTGGTCACTCGCCACCGTCGACTTCACAGCCCGAGACGCGTCCGACAAGCGGAACACGTCAACAGTGTAACTGCTGACCACACC
ACCACCCACGTCAGCAGGTAATTGCCACGCCAGCGACACGCTTTCCTGTGTGACGGTCGAGGCTGTCAGTCCTTGCGGGGCACTCGGCTTGGTGGCGGTG
ATCGTCGTAAACACTACCGGCTCACTAGCAGGCGATGCGCCAACAAGATTCACGGCACTCACGACTGCCGTGTACTCGGTCAGAAAGTCGAGCTGAGTGA
TGAGACACGACAGCACGAGACCGGAGCAGTTCTGCACGAAGGTCTTGCCAAAATTCACTGTCAAAACGTAAGTTGTGAGCGGTAAGCCACCCGTGTCCAC
GGGGTCTGCCCAAGTCAGCGTGGCAGATCCACCGGTGAGAGTGACTGCTCGCGGAGCGTCCGGGGTACCGGGGACACTGGCGGCCGCCGTCTTTTGGGAG
TTTTCAGCCGACACGACGCTGCTGCCGGCATCGTTGCTAAGACTCACGGTAAATGCGTAGTCGATCAATGGGAGCAAGCCACCGACCTGAACGACTGCCG
TCAAAGCTTTATCTGAAAGTCCACTCCCACCACCCAGCGGGTCCTCAAGGCGACGCGACCGTGTTTCCGGGGTACTGAGTCGCCGGTGCCACTGGATATC
ACCAGGCGAGTCGACCGCCGATGCCGTAGATGGTCTGCGCAGAATCTTGATAGAGGACGCAGGTACCAAGACGCCGTTCGCGTAGACCACGTAGACCAGT
TCGTCAATGGCGGCTCCTCCCGTGTCTGACGGTAGAACGAGCGATAATGTCGCTGAGCCACCGGAGACAGAGACAACGGAAATGGCTGATGGTGCTGACG
GGATGGTCACATCGACAGTAGACAGAATCGCGGTCACACCAACGTTTCCTGTACCCAAAAAATTGCCGGCGAAGACCGTGATTTCGTAATCTGTGTTGGC
CAGCAAACCGCCCACGCTGGCCTGGGTCATTGCCAGACGCGTGGATACACCATTCGCTTCCACGACGTAGTACGTGACCTCCATACCGCCGTTGTCTTCC
GGCGGGGTCCACTCAAATCTTATGAGTCCGCCTGTCCTGCTCAGCAATTTGATCGACCCCGGAGGTCCTGGCACAGATACGTCCGCGGTTGTGAGCTCAA
ACACACTCGACTCGTTCGAGTAGCCAACGTAGTTGAGACTTGACGCCTTGAACAAATAGGACGTGGCGTTTTGGAGCCGCGACTTCCAAAACGACGTCGC
CGAGTCGTTGTACACAAGTTCCCACTGGGGCGTTGACCCTGAGACACTCATGTAGACTTGATACAGCAAGTCGACTCCACCGCCTCGATCTCGCGGTGCC
TCCCACATGATCTCCAGCCCACCTCCCGTCGTTCCTAGCTGCACAATCTCTCGAATAGGCTTGGCCAGTGACGGTACGCCAGTCATGAACACTTGGGATG
CGTAGCGGAGCTGTTCAACTGTTCGAGGCACGTCAGTGCCGCAGCTCGAGACATCATTGACCGCAACCGCGAGGAACGCGTAACTTCTATTTGAAGAGAG
TCCGCCGAGGAGCAGCTTCTTGTCGATTTGTAAATCACTGCGTTCAACGCTCTCGTAGAAGAGCATATCGTCGTTGTCTTCATCAACCAGCTCTCCGTCA
ACATACAGATCGAAGCCGCGAATCACAATGCCGCCCGTATCGTTTGGCGATGTGAGCTGGATGGTGAGCGCCCCACCGCTTGCCGACAGGAGTCTGGGCG
GCTCCATTTCACCAGGTTTGGTCGGCAGTCCAGTCTTGAGCTTAATCTCATTACTTGGCGCCCCCCGCACAGTCAAAGTTCCGTTCGCTTGGTCTTCCAA
TGTTGGCATCAGCGCAGCCTCGTCTTCGCTTCCCGTACCAACTGTTGGTTGGTAGCTGATACTGCTCGTAGTCGCGGGCTGCGATGGATCCGCTTGGAAG
TAGTAGCCCTGTCCGACAATGACATCGATCCGTCAACGTCCAGTACCCAACGTGAAGAGCTTCGTCATTATAAGAAACCTCACCGCAAACTCAAAGTACC
CGTCCTCTGCGAGGTCATCCGTCATATCGACGGTGACCACGATCGCGGCGTCATCAAGTTGTAGAGTCCCATTGATTGTCGGAATGGAGGAATTCGTTGT
AGTCGTCACAGCAAAGATTTCGTACTCGGTGTCTGCCAACAGCGCGAAAATAGTTCCGTTGTTGTGCTTCGACACGACTTGTTGGGCTCGCCGGAATCGT
TCATTTCCACCGACCTTTCGGTAGAACAGGATGTAGCCAAGATCTTCATGATAGCCGCCAGTGTCTTCTGGGAGATCCCACTGAACGCCGATCGATCCAC
CTGTGGTTCTTGTGGCCGTTGAACGTAATCGTGGAGGCAATGGTGGGGAAAGCCGACTGCTCGCAAAAGTAAACGCTTCGGATGCGTCTCCGGCACCAAG
AAAGTTGAGTGCCTGAACATAACCATTAATGCAATATCAATATCGAGTATCCCCGACCTTACTCCCCGGTCTCTTACCTGTACTTTGAGCAAGTACTCTG
TGTCCGGAAGTGGGACACTGACGTTGACGAGCCGGGAAGATTTAAGTGAGCTGTTGGCCACCACCTACAACCCAAAAAGCTCAGTGAGTGCACACCCCAC
CCAGTTCATCTTCACACGGCATGCCTGACGTTGTAATTGCCGCTTTCGTCATCAAACATGGAGACCACGAATCCAGTGACAGGAGCCCCGCCGGTGTCCA
TCGGGTCATCGACCAATAAACGAAGCATGCCACCGGTTGCGCTATCCAGCGTCGCGTTCGTTGGCGCCCCCGGGCGAGTAACGTTTGTCGTCGTGGCTTC
GTATTTCGGCGAGTCTGGTCCCAATCCCTCCACGTTGGCAGCTGCGACCGAGAAAGAATACTTGGTGAGAGGCTCTAGCGACCCAATCGCAAAACTCGTG
TCATTTGTCGATCGGACGAAGGTCTTCGATGTTGGCTTGTCCGCGCTTCCGGGGCGGGGTGGTGCAATCATCGTGACGCTGTAGTGTGTGATCCAGACGT
CATTTCCACCGACGTTGACTGGCGGTGACCATTGAATCACGAGCATCCCACCCGTTGCTCGCGCCACTGAGAGCTCCGCGACATGGCCTGGCGGTGAATG
GTCCCCATTATCTTCAATGGTGACAGTCAGCTCACTCACCTCTCCAATTCCCGCACCACCACCGACCACTCTCAGCTTAAGCTTGAAGAACTTGAACGGG
AAATCATAGTGCACGTCATCTTGAATCACAACTTTCAGCACTTCCCTGACGACACCGTCGCCAAAGGTGACATGCGTTGTTTCGAGAAAGAAGGCCGATC
CGAGAACCGCGGTTCCCGGCGCCTTGTCGTCGACGCTCACGCGCACAACGGTCGCCGAGCTCATTCCATTGACGCGCACGAGTGGAACTGCTAGCACTCC
AGCCGATTCATTCACCGAGATGGCGTCCTTCTCAAACGAAATGACGCCAGCATCTCCATCGTCCTCNNNNNNNNNNATATACACTGTCGCTGTCTGAGGC
TCCACAGCATCGGTTCTGTCCGTTACATCAAACAGCGTCAACGTGACCAGACGCAGCTGCGGGTTGTACAAGGCGTTGTCGATGAAGCGGATCTCGAACT
CCTTCTCAGTCTCGCCATCACCGAAGGTAAAGCTGCGCGCAGAGACTACGTCCAAAGCGAAATCCACGTCTTCCACAGCCATGGTTGCGGACGCGATCGC
TAGAGCTGGTTTCGTAGTCGATACGTTGTACAGACATGTAATTGTGCTTGCCGTGCCGTTCTCGCGGACGAGAGTGACGAGGAGAGACGTCGCAGTCTCC
AACACTGTAACGTTGGTGGGCTTGAAGGTCACGGCGCCGCGTCGGTTCACATCCGTTTGTACATTGATTGGCCCCGCCCACGGACTGCTGCCAGCCGAGT
TAGTCGCTCGAAGTCGAATCGTATAGTTGGTGGACGGCATGAGTGACTCTAATGCAAAAGGTGACGCAGATGCAGACGCCTTAACGGCCACCACTGTGGT
GATATCCGCGTACTCGATCTCAAACACGATGGCGTCGCCTCCCGTCTGGTCAGGACCTTCCCACCCCAGAACGAGTGAGTATGGGTGGCGCTGCATGACA
GCAAAATTGTACACGACCGACGGTGGAATCGGTTGCGTCGTTTGAAGAACCAGTGGTGAGCTTCGATCACTTTCCGCGACACCAGCGACCGTCATGACAG
ATACCGAGAAGTTGTACTGGGTCATCGCCGCGAGCCCGTGAATCTCTGTTTGAATGGACCCCGAGGCTGACACGTTGGCCACGTGGACGCCATTTCGATA
GATTTTGTACGATGAGACACTTGCGCCACCAGTATCTGCTGGTGGACTCAACGAGAGCGTGACGGCCTGTGCACTCACAGTGACTGCGATCGGAGGCGGT
GGAGGAGAGGACCTTGACGGTGGGCCTGTTCTCACTTGAACAGTTGCGATAGCACCAGCACCGACGACGTTGACAGCCACGACGGAGACCACGTAGGTGG
TGTTTGCCTGCGCCGAGATAAACGCAAACTGCGGTATTGTTGTCGACGTCTGCTGAATCGGAGTCTGCATCGCCGACAGTAGAAACACGCTGACGCGAAA
CTGAAGCAGCGGCACACCACCTGTGTCCACTGGTGCGCGCCATGTCACGTTTAGCCGACCACCGCCCACAGCAATTGCAGTCACATCTGTCGGCGCGTTT
GGAGATGTCGGCACCGATGAGGTCGATGCTAGCAATCGGTCACTGACGGCGCTGAATCCGATTGCGTTGGCGGCTCGCACAACGTAACTGTACTGCGTGC
TCGCAGAGAGACCCTCATCGAGAAAAGTTGTGCTTGTGATGAGCTGGTCGACTGGAAGAAGAGCGACATCGTTTCGATAAACTTGATAGCACAGCGACGA
GTTGTCTCCCCCTGTATCCATGGGCGGAGTCCACGCGATCCGAATGGATCCACCTGCCGCACCTGACACACCGACGATACCGAGGGCAGTCGGCACGCCT
GGGACAGACGAAGTCGCTGCAGTTTTCCGAGATACAAGAGCACTTCTCTGACTGGTCCCAGCTGAATTAGATGCAAGCAAGTAATACCCGTACGTCTGGT
TTGGACGAAGTGCGCCGCGCTTGAATTCTGTCCCCGGGCCTCTGTAGAGAAGCTCATCACTGTACGAGTAGAGGAGATAAGAGAGGATCGGCTCGCCTCC
GCTGTCGATCGGAGGACTCCACGTGACGACTTGCATACCGCTTGTGCTGGTTACAACTGCCAGGTTGAGCGGCGTCTCGGGTGGCGTGGTGGGTAGCGTC
GTGGTAAACACGGTAGGATAGCTGAGGAATGAAGCTGCATCGACACACGCCGTGATCTCATTCAGAGCGATCACTAGGAAGCCGTAGGTCGTATTCGCTA
GCAGCTTGGACACGCGAGCCGAGATAGTTGTAGCAGCAAAGCTCACGTTGGCGACGAGTTGCTGGTACTGGAACTG