Description :
From Genome Similarity Track
Location :
Scaffold_840:9324- 13834
Transcript NameFunction/comments
g15280.t1hypothetical protein
g15281.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g15282.t1hypothetical protein

Sequence
4510 bases(100 bases per row)
ATCCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGACGAGGAAGAAGAGGAAGCTGCGCGGGACGAAGACT
TCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGAC
GCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCG
ATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGG
GACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTC
GCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAG
CTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCCGATGGCTATGTGGACGAAGACCACCCGG
ACCACGTATGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAA
GAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTCTACGTCGACGACTTGGTCCTCGCCAGCAGCAAC
GACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACG
ACCACGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCACA
AGACCCCGGACTCAAGCTGACCAAGATCATGTGTGAGGGTGGCTGCCAGCATGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACAT
GCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGT
CATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCT
CATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCT
CCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTT
CGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACT
GCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGAC
GGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAAGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCA
TTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCG
ACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACAGACCCTACGTGCTTTAGCAC
GTACGAGGATTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCAT
GACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCC
TTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCA
GGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCT
GGTTCCCAGCAGCGTCGAGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGA
GGAGCCGTCGTGGCGATACTGGGTATCGCCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTC
GACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGCCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAA
GCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGT
GAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAG
GAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGA
CGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGACCCTCC
ATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAACGAATCAGCAGGGC
CTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGCTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCG
TTAGGCGTCGAGGTAAAGAAGGCGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTC
GCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTG
TCCACGGCCGGGCCTGGACAAGAGGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGA
CCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAAGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATA
CAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGA
CGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGGCGTGTGAAGCAGAAGAGCTGAAGCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCG
CGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGA
CGACATTCCTGCGGAATTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCG
CGTGAGAAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTG
TGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACCAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGAT
CATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTTACGGCG
GTAAGCACTC