Description :
From Genome Similarity Track
Location :
scaffold_810:9323- 12068
Transcript NameFunction/comments
g10335.t1 hypothetical protein PHYSODRAFT_511466

Sequence
2745 bases(100 bases per row)
AAGCTCACGTGTATTATCAAATAGATCCGCTGGCTTGACTCTAACTTGATCCATTGACTTCTTGTTCACATATGCATAGATGTAACACGTAGAATGCTCG
TCTCGTACCGGATTCAAACCCGGCGAGGGTCCTAGTTTAACATCTTCTCTGCAGCCTCCGGAAGCATGTGCTTGGCAGGATCAAACCACTGGCGGATGAG
GTTGTAGAACTCCTCCATCTGGCACTTGCCGTGATCGTGGAGCTCGCCGCAGCCTTGGCAGACGAAGAAGCAGCGATCCGACGGGTGGCCTCTCTTGCCA
TACTTCTGGTAGGTCAGGCGCTTCCAGCAGCCAAGATCCGAGTGTTTACGGGATCCTCAATGCGTACAGCGCTGTCCGTCGTTGGAGAAGCGAGGCCGGC
GATCCTATGGCGGTGGATCCGCACTGGTTTGAGGCGGAGCCTTAGGATCCGAGGATCTAGTCGCTTCCTTGGTCGTGGCAGCTTGCTGCTGGTCGCTCGA
CGCCGCGACATACGCCCGGCGCAGTTCACCTTCGGATCCTTGACTCGTCCGGATCGGATCCATACTCCGACTCAGCCATCTGCATGGCTCGGATCGCGCG
CGTGGGGCCTGTTGATTGCGGTGCTGGTGGTGGCTCGGATCGGGCCTTGCTGGATCCAGATGGCGGCTTCTTCTGGCGGGACGTTGCACGATCCCGCGCA
CACAGTACGTCTTCCAGCTGCTCCGCGTCGGCAAACCGCAGCAGCGTCAACTGGTCGGCGGGCTCCTAATCGCCAAGCGTCTCGATGAAGTGCTCCACGG
GCTCTCGGCGGGACTTGGCGTTCCTGTCCTTGACCTTCACATGGGCCCGCATGCCTGCGACGTTGAGGCGGTACAAGTACTCAAGTGGCGACTCCCCCGA
GCACTTGCGCACGTGGTAGTACTGCCAGGCCACGGACACTCCAAGGCCGCAGTACTGCGTCTGGAAGCATCGCAGCAGATCGCTCCACTGCATCCTCGTC
GACCGGCCTAGTTGTCGGTACCTGTTCCTCGCCGGACCCGTGAGCAGATCCGCGAACGATAGGCACATCTCCTCGTCCGAAGCTTGATCCCTAGTGAATG
CAGACTTGACCTTGCTTATCCAAGCTCTTGCTCGTTCCTCGTCATGGTTTTGGCCCGTGAACTTCTTCAGGTCCGAGATCGCTGAGATCATGCCGCCTTC
AGTCGTTGCCGTCGCTGCCGTCCGCCGTGTACCCGCTCCGTCGAGGTTGTCTGGATCGTACTTCCAATGTTCGGGATGCGATCCTACCGACTCCATGTCG
ACGTCCTGAGCTCCGGCGTTCACCGCAGCCACTGTCGTTCGGGGAGCGGTAGTCAACTGCCGCTCCTTCAAGAACCAACTCATCGCCGACTGGAAGTACG
CTTCCAGCCTGTCGGTCGACTCGTGCGACGGGTCCTTGGCAGGCGTTCGCTTCGGCAGTGGCTTGGGGATGGCTGCGGCAGGTACAGGTGCAGCGTCGGG
GATCCCGATCGGCAAACGGGCTCGCAGCATGGCAGATCCTGCCGGGTGGAGCGACATGCGCCGTGGTTTGGACGAGCAGTCCGACCCAGCCTCAGACTCG
GCCGAGGCGTACCGAGACGATCCCGCCTGGTACTCGGGCGAGTTCAACTGCACGTTCTTGGTTGCTGGACGTTTGGACAGGCGTCGTTCTCCAACCAGAG
GTGTCAGCCGGCTGAATACCAAGGTTGCCGCCGTCCGGATCAGACCATGATCTAGGCGGACGAGCGCCTCGCCGTCAAACGCTCCAGCTGTGAATCCAGC
TTCCTCCAGCAGACGCAGGAGGTCCAAGGCGCAGTCCAGGCTGGTCGTGGACGACGCGGGCGCCAGCACGGGGCCTGTGAGAGATCTCAGCAACTGTGGT
TGCAGGATCCTCATCACAGGATCTTCCCGTAGAAAGTCTTTGAGTGAGACTCCCTATTACGCAGTCCCCAGCTTGGACGACGTCCACTCGGCCTTCGGTG
TGGGCTTCTCTTCTGCGTCAGAGTCTGGTGCCTCCAACTTCTTCCGCGCGGTCTTCGTCTTCTTCTTCGACGTCTTGGCACCCGTGACCGGCGCGGTGGT
GGTGGTGGATGAAAAACCAATAGCTATCGCCATCGGATCCCCACCCGGCGTATCAAAGCTCGCGCTTCTTCCGAGTCTGTCGCCAGACTGTCCTTCTTTC
TGTCGGCAGAGCTCCTCCAGGACTCTGTCGATCGGTGGATCTCGCGTTCAGCGGTGCCGGCGGCGATCGAAATACCGTCGGCACTTCTTCTCCCGGTTCT
TCCTTCACTTGCACATCTTCTAGGGACTCACGGTGATATCCGCCGTCCCCAAAAGATCCGGGTACGCGCACCATTGTGGTGGAGTGGATCCGCTGGAATG
AGCAGGGATCGCACACTCACACATGGCGCCCAGACACTGACTAACGGAGGGGGTACTCCGATAACCGTGGGGTCGCTGAGAGGCTCATCTTGTGTACCTG
TCAGTGGGCGGGATCTGCTCTCTTGGGGACAGGCGTGATGTGCAGTGGTGTGAAGCTTGAGCGTCCTTGGCGGGGACTGGGAGGTTGGATCCTGCGTGGG
TATTCCTGCACACAGGCTCCGGGTAGGTAGATCTTGGTCTTGTAGCCGAAGATCTTGTGGATCCTTGGATCCGGGGGTTGCCTTGTTGGTGTATTCCTTT
GCCTTTAACTTGTTGCTTGCCGCCTCCTATAGCGGGGATCTTGGG