Description :
From Genome Similarity Track
Location :
Scaffold_624:9322- 11368
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_624-fgenesh-gene-0.3Heat shock protein 101
Pytve_DAOMBR484maker-pve_contig_624-snap-gene-0.17Serine-rich protein

Sequence
2046 bases(100 bases per row)
CTCAAGAAGTACGGCCAGAACCTCGTGGAGCTCGCGGAAGCCGGCAAGATCGACCCGGTGATCGGCCGTGACGAGGAGATCCGCCGCGTGATCCGCATCC
TGTCGCGCCGCACTAAGAACAACCCGGTGCTGATCGGCGAGCCGGGTGTCGGCAAGACCGCCATCGTCGAGGGACTCGCGCACCGGATCGTCATTGGCGA
CGTCCCAGATACGCTCAACTGCCAAGTCATCAGTCTCGACATGGGTGCGCTGATCGCCGGTGCCAAATACCGCGGCGAGTTTGAAGAGCGCCTCAAGGCG
GTGCTGAAGGAGGTGAAGGACAGCGACGGCAAGATCATACTTTTCATCGACGAGATGCACCTCATCCTCGGCGCTGGCGCCACCTCCGGTGCGATGGACG
CCGCCAACCTCTTGAAGCCGATGCTCGCGCGCGGTGAACTTCGCTGCATCGGCGCCACCACGTTGGACGAGTACCGCAAGTACGTCGAGAAGGACAAGGC
GTTCGAGCGTCGATTCCAGCAGGTTCTCGTCAAGGAGCCGTCTGTCCCCGACACCGTGAGCATCCTGCGAGGCCTGAAAGAGCGCTACGAATCGCACCAC
GGCGTCCAGATCTTGGACAGCGCGCTGGTCGCTGCCGCGAAGCTCGCGGACCGCTACATCAAGGAGCGGTTCATGCCTGACAAGGCGATCGACATCGTCG
ACGAGGCGTGCGCGAACGTTCGCGTCCAGCTCGACAGCCAGCCCGAGGTGATTGATGAGCTCGAGCGCCGTCAGCTGCAGCTGCAGGTCGAGGCGACCGC
GCTCGCGAAGGAAAAGGATGAGATGAGCAAGCAGCGCCTCAAGAAGGTCCAAGAAGAACTGAACACCATTGGCGATGAGTTGAAGCCGCTCATCCTGCGC
CACCAGGCGGACAAGGCGCGCGTGAACGAGGTGCGCCAGTACAAGGACAAGCTCCAGCAGCTGCAGCTCAAGGTTCAGCGAGCTGAACGCAACCAGGATC
TGCAAACGGTGGCAGATTTGAAGTACTACGCGATCCCGGACGTTGAACGCCTCATCGCTGAGGCTGAAGCCGCCAAGAAGCGCGAGGACGAGGACCCGAA
CCACCACAAGCTTGTCGAAGAAGTGGTCCGCGAGGAGCAGATCTGCCAAGTGGTGGCGCGTTGGACCGGCATTCCAGTTTCTCGGCTCACATCCAGCGTC
AGCGACCGGTTGATGCATCTCGACGAGCGCATCCACAAGCGCGTCGTGGGCCAGGAAGAAGCCGTTCGGGCCGTTTGCGACGCCGTACTGCGGTCTCGTG
CGGGTCTGGCACGCCGTGAGCAACCGACCGGGAGCTTCCTGTTCCTCGGACCTACGGGCGTCGGCAAGACCGAGTTGGCCAAGGCGCTGGCATTCGAGCT
CTTCGACGACGACAAGCACATGGTCCGCATCGACATGTCCGAGTACATGGAGGAGCACTCTGTCGCTCGACTAATTGGCGCGCCGCCAGGCTACATTGGC
CACGAAGAAGGCGGCCAATTGACGGAAGCTGTTCGCCGCAACCCGTACAACGTGGTGCTGATGGACGAGATCGAGAAAGCCCACCCGAAGGTGTTGAACA
TCTTGCTGCAGCTGCTCGACGACGGCCGCCTGACGGACTCGCATGGACGCACGGTCGACTTTGCCAACGTGGTGGTGATCATGACGTCGAACATTGGCGC
CGAGCATCTGCTGTTCGAGACGGACCTGTCGCCGCGAGCTAACAAGAAGATGCGCATCGAGGAGACCGAGAGCCAGGCGAAGCAGTCGTTCAGCAAAGGT
CGCGAGATGGTGCTGCAGCAGCTGCGCCACACCATCCGCCCGGAGCTTCTGAACCGTCTGGACGACATTGTGGTGTTCGAGCCGCTCGGCCGCCGAGAGC
TGCGCCAGATCGTCATGCTCCAGTTCGAGTCGGTGGTGAAGCGCCTCGGCGAGTCGCAGATCACCATGAACATCACCGTCGGCGCGCTGGACGCGATCTT
GGACGCCTCGTACGACCCCAAGTACGGCGCGCGTCCGATCAAGCGG