Description :
From Genome Similarity Track
Location :
Scaffold_98:93208- 100235
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19002hypothetical protein
Phypa_INRA-310PPTG_19003hypothetical protein
Phypa_INRA-310PPTG_19004hypothetical protein
Phypa_INRA-310PPTG_19005hypothetical protein

Sequence
7027 bases(100 bases per row)
CGACCACGTTAGCAGCGAAAGCACAAAGCTTACGCGTGGAATGGACCCATCATTTCAGCACAGAGATCGTCCAACCGAGTGACATCCTCGTCATGTGTGA
GGAACCTCGCATACGCCTGTATCCTGTGGTAATTCAGAACATATCAGCAATAAATCTTAATCTCCTTTGCAAAGCCTGAACATACCAATACCGATACTCG
GCAGAGCTCTTCAATATGATCGCAGTGGCAACTTGGTGCTCGAGGTGCGAGCGTGTCACGTTGCGCTGCATCAGCGGGTCCGACATAGTCGAAAGCATTG
CCGACGCGATTCCTCTCTGGGTCCGGCCATAGCCAGACGCGTTTTGAAGCCGTCGTAATGGCCCGATCTGCCGTCCATAATGCAAGTTACACGGTTAGCT
ACTCGGTACATGATCGGCTGGACAAAATACTATAAGCGCCTCCGTACAGGAACACTTTTGACTGTGACTGCATCTGTGGGTAAGGCAGACGCAAAATCCG
AGAAAACGAAGCTATCGTCCGCCACCCGCATCCTACAACAAATAAGACCAAAACATTAAATCACGATCGACTTCTAACTAGAGCAGGAAAATGTCCGTAC
CATGATGACATTCCAGTGTCGAATGTGTATGAGAGCAAGCTGGAGTTACCTTTCGTTTCCGAGTTGGACTCTGCAAACGTGATAAGCGGCATTCCTTTTG
TCGTCACTTGACACCGGAGAAGTGTCAACTTCCGATGGTCTTCTGGCGTGATCTACCGACACAACACACGACAGAAATCAGAAATAATATCCACCTTAAT
GAAAATTGGAGAAGGCTAACTCACATTTGTAATTGCCTCGATGGAGCTTGAGAGCACGAGCTTGCGCTCCGCTAGATTCCAGATTTTGAGATCACCTGTC
GCCAGAATTACCAACAGATAGGGCGACTCGCTCGCACTGCACTCCATTACTGAGATGGCACTACCCAAAGCTGGAAATGAACAACGAGGCAACGTTAGTT
TCTGAGCGATCAAATCAAGTATATAAGCTGATATACACACCAATAGCAGGAAACAGTCGTCGTCCGCTGCTGTTGAGTACAAGAAGGTCGCCATTGTGTA
CACCGATAGCACAATAACTCGCGTTTCCCACTGCACACACGGCTCGGCCCGGAATACGGTCGATCCACTTGACTTCGCTACCGTCGGAGCATTTAATAGT
CGAATAAACTGGGCCTAATTCTGCATAGCAGCGCGATAATCCACAATATCAGCGGTCATTCGTACACATCAGAGAGTTACAATCAGCACACTTTACCTAT
GACTTCTTCTGGCTGGGGATTCTTCAGGTTATGAACAGTAACTTCCACCACCGCTTTCGGAGATACCAATCCACTTTCTGTTCTACCGTTCGAGCTGGGG
TTTGCCGCATTGGATCGTGTCGATGCGTCGATTTCTACAGAAAACTGCAGTCTGAATGGGAAATCAGGAAGCAGCTGGCCACCTCTGGCCACTCCAGCAC
TGCTGCACGTGCAAGTTAGTATCTGTACCACGTACTGAATTTTATACAGCATTCAACAAACCTTTCATTCAGGAGCTTCGGAGGCCGCGCAACAACTTCC
CTCGACTTTGCAACCACAGTAGTGGTGTGAATTGGAGGACGCTCACTTTCTCGTTTTCTCTTAAGAGAATTTCCGTCGACCCCGTTTTTCTTCACTTCCA
TCTTCGACGGTTTAGAATGGGCATCGGTTGTCTTCGACATAGCGGGTTTTTCCTTGGGAGCGGGTCCTGTCTTCTCGCTATGGCTCGGCGCAGAACTCGA
CGAAAGCTTTGCAGAATTGTTCGTGTCGGGGGCAACGCTAACCTCCTTTCCACTTGTTGACGCCATGCGAGAATCCAAGAGTGTCACGTCCGACGCTGTA
GGTGACGAGATTGTCGGGCCCAAGATATTGCGGATATTGTTATGTGATGAGGCGGGATTGTTGGCTAAAGATTGCGCGTCAGCTTGAAGGAGCACCGGAG
CGATCCGCTTTTTGTCGCTTGCGTTCGTTCCAGGCGGTAATTTGCTTTGAAGCGCACTAGATGCTTGTGTGCCAAGCTTCTTCTTCTTCTTTGGAATGAG
GGTGTTTGTTGTGTGGGCTACAACGGGAGCAGCAATTGTACCAGAACTCTGACTGACAGCCAAACGTGGTGAAGTTGTCGACTTTTCTTCAAGCTAGGCA
CAGCATAATATGATTAAATAAGTAGCCTTGTCCCACATCAACCGACTCAAGTTTAAACGTACCTGAAGTTGAATTGGATTCTCCACAAGAGTCGATGCAA
GGGTAATGCCGGCACGGGATCCATACTTTATGTCGAGCAGAGGATAAGGTATGGAGAGAATGTCAGGCTCTAAATGATACAATGCCCACGGAATCACGAA
ACAAACCTTTGCCTGAAGAAGTTTACTCTGCTGCGCGTCAGAGATCGGAGTACCAATCTCGTCGCCTGCGAACTGAAAGCAGCAGATAGATCCATCGAGC
GAGCACGCGAGAAGAAGTGACTGGGAGCTAGACCAAGTGAGATCTGTGACTGATGAATCAAAGCAATCCTTGATCACCGCCAATGGGCGAGCTAGATGTG
CCAGCCAGATGCTTACAGTCGCATCTTCACCACCCACAGCGCAGCATGCGAATTCCTTATCCGGATCTGCCTTTGTTACTGCAGAGCAATACGATAACAA
GATGATTAGAACGCCATTATATCCTCGGCGCACTTGATCAACGTACCCAGTAATTTAGGGTTAAATCGTGCACTGGTCACGACGCCCTGATGACCCACAA
ACTTGAGATCGTTTGTCCAGGATCCGCGGTTAAGCAGTGACGCGATGTTTTTCTTGGAACTGAAGGCGTGTGTGGCACAGAGGACCGATCCATCAGGAGA
CCACGAAAGCCGACGGAAGTGTGAAGTGGAAGCACACCCCTCGAACGGTTCCGTCACGACGTCGGACTGCTGCCAGTCAGCTACCTTCCACATCCGCACC
GTTTTGTCCTCTCCAGCACTCGACAGATACTACAGCAAGCATCGATCAGAAACCTCAACACCATTTACAACCGTCACTCCACACAGTCACCTTGCCAACA
GGATCCCACGCAACGCCCTTGACCCATCCGTTGTGTCCTGTAAGCGTCTGCAGTGGTTGCGTCATGACTTCACTCACTGCACCCACGCCAACGTCCCAGA
TCAAAATGGTATTGTCGATACTACAGGTTGCCAGCATCCGATCGTCCGGCGACCACGCCACGTCCGCCACATCTACAAACAGTTGCCAGCATTTAGCACC
ATAACCAACCAGTCTTCAGAGTGCAGGACTCTGCACTCAGTCTCGTCTCACCCATCGTGTGCCTCTCGAGTGTGGAGCAGCGTACCCAGTTCTGCTTGTT
GGGTCTTGCGTTGGAGCCGAAGGGGACAGGAGCTGGAGCACCTGCTTGTAGTTCATAGAGCAGCACCAGTTGGTCGTCCGATCCTGAGGCCAAGTAGCGA
CCATGGCCTGCCCAGCGCACACAGTTGACGGCCTGTTGGTGGTTCGCCAATGTAGCCAGCAGCTCAAAGGTGGCAATTCCTCCCTCGGCTGGCGTCTGCA
ACGACCATATCTTTACTGTGTTGTCTCCACCTGCCGTCGCAAAAAGCTGCAGCGTCGGGTGCGCGTCCACACCGTAGATGGCGCACACTGTGCAGCATTT
CGACAGGTCAGAACGCAGCAACGCGAGCGAGTACAAACACCGCGAGTACGGCGTCAGTTAGGCCAGTTTCTTGGTAATATAACGAGCGCGTACCGGTACC
CGACGAATTCTCGTGTTTGACGTCCTCGGGCTTCTCCAGCAGCATGTCTTGTGCGCTCTTCAGGTTGGCGACGATGCGGTTTTGAACTTTACCTGCGTTA
GAAAATATATATGATTTGAGAGGTAATTGAGTCTAATTGTAGCCATGTGTCATGAATATGGGTACAAAGTTGTTGAAGTGTGATGCAGACGTTCCTAGTA
GCGGTAGTCTGCCTGTTGCTGTCATGGGCGAGCTCAACGGTGGCGATCACGCGGAACGAGCGTGGCGCGTTAAAGCTGCTGTACTGGGCTACACAGGGCC
AACGTTGGGTTGGGCAATGGGACATCCAGAACGACCACAGCGACCCGTGCCTCGACAACGTTCGCAACCATGTTTCTTCACTGTTATTTTTTTTACTTAC
GTCTTATTCTGTTAATGATCTAGTGGTACGGCATCGTGTGTGATCGGAACGGCCGGATTCGGGCCATGTAAGTGGACCTTATCAGTGCAGTTCCCTTTGG
AGACTTAACTTCTGCTATTTGCTACCTATTGCAGCCGCCTAGCGAATAATAATCTCGTGGGCGTCCTGCCGCAGCAATTCCCTCGCAAGGACCTTAGTGG
CCTGCAAGAACTGTGAGTGTGTTTGTGCTCTACCGAGAGCGTCTAAACCTATTCGAGATGGATTGCGGTTGCAGAGACCTAAGTTCCAACTTCTTGACTG
GTTACGTGCCCGACACGCTATCTCAACTCGGTGCATTGCGAACGCTGCGCCTCGATCGTAACCACTTCGTGGGAGCAGTTCCAGCATCGTTAGCACAACT
GACCAGGCTGGAATTCCTGTAAGTATCCGATTGTCCACGATTGCTGCATTATTTGCTGACTGGATTACAGTGAACTGCAAGAAAATAAGTTCGACCCACT
CAACTCGAACGGAGGTGTACTGCCTGAAGAAGTTCAAAAGCTCACAGAACGACAGCACTGTCACATTATTTCATGAAAACAAAAGAAACGAACTTCATTT
CCTCATTCTCCTTACACCTGCGGTGTGCAGCGTAATCATCGGCGTCGTCGTCGTAGCTTAGTCATCATCGTCGTCGTCGCTGCGGTGATGATGGTGATGA
TGATGGCGAAGGATACGTGGTGTAAACTCCTTATCTTGCTTTGGTTTTTTTTCCAGCGAGTTTCAGAGAAAGCTTCATGTTACCGGAATCTCTTTTTTTT
TCTTTGATTTTAATTGAAAAAACAAGTTTTAAAGTTTCATACAGTGATGGTAGAAACAGCATCATAGAACGTCGACAGCAGGTGTAGATGAGGCACCTGC
TGCATCTTGATTCGAGTAGGCGTGCAGACAACCATCATCAGTCAATTTGGAGGCACCGAGCATGCGTACAGTAGAGAACGGATCCACGACGAGGTCTAAA
AGACCAGCCGCCAGCTCAGCGCGGGGCTCCACATTAAACACCCGACCGGCCGAGTTGAAGTGGAATCGCGATACGAACGGGAAGTCGTAGGTCTTGCCGA
CAAGACGTTGTACCATTTCTTCGTCGGCCAGGAGCGGCTGGAAGAAATGTTTGATGGTGTCACGTGAGATTCGCAGGGTGCTGCGTCCAATGCATTGGAC
AGGATACACGTCCGGATCGTCGCTCTCCAGTGGCTGGATCTGTTCACAATGAAGTGTAATCTCCGCGTGATAGCGCGAATAGTTGTGCCATTGCATCAGG
AACGTGTCCAGGTCGCGGAACGCAGGAGATTGCACGTCCGGTAGCATCATGCTTCGCAGCAGTGCCTCAACCTCCCACGCATTGCTGCGGGTTGGGTCGT
ATCCGTGCGAGAAGCTGCGGTAGTATGAGTGCACTTTATCCGCTACGAGTTGCATGGCATTCGCACGACGCGCGAGGTGCAGTGCTGAGAGCAACGCCTG
TCGTCTTTCGAGAACCAAGACTTGCTGGCGCATACGCTGCATCTCTTGCCTCGCTAAGATCTCGCGCCGAGTCTCAGTCTGGTTCGCGGCGGGCTTCGAA
CTCTGCACGCGTCTGAAATGCCGATTTGCAGGGCCAAACTTGCTCAGCGTACGGCAGTTCTTGGACACCCGTCGGACGCGTCGCCGGCGCTTGTGTGTAG
CGAGCGCTTCGGCTTGTATGGTTGCCTGGGTAATCTCCTTTTCTAGCGCCGCCATGTACTGCGGAGAGTGATCCACGGGCCCTGGGTTCGAGATAACTAG
CGCGACGGCGGAAACGTCGTTGGCGACAACTTCTTCATCAGGCCACTCGTCGGCAACACGCACCGCTTGAGACTCTGCAGCACAAATTGTCCATCGCGTT
TGGCTGCGTTTGTTGAGACTTGACAGCATGGCTGCAGCTTCGGAAGTGATCGAAGAAGCGGCCGAACTATTTTGGCGTCCTCGGCAAACGAGTCGTTTAA
CAACTGACCACTAAATCAACCGATAGAATTAATCCATGAACGAGGAGACACCAGCGCTGAAATGCTCAACGCACTCTTCTTCCTTTCACAGTGCGACATC
ATCAAAGCTACGAAGCTAACATGTAAGTTAGCAGTTCCCTTGGGCAAGACAGACGAGCATCAGGCAGATAAAGGAAGATCTCGCCGCATGTTGAGCTTTA
TTAAACGTGGCAGCTGAACGCCTCGTTTCAGTGGGTCGCGCGTGTAACTGCGTCCGTCACGTTCACCAGGAATCCTGGTAGGATTGAAGCGTTGGTGAGA
TGAAATTCCCCACGGGGCCCAGTTGCAGAGAAGACTACCTCAGCACTTGTTTGAGTATGGTCACCGCTCAACGATAGTAGTCTTCCCCAACGGCTCCCAC
TAAGAAGACATTTTGAGCTCCATTAAATGGACAAATTTTGTGCTTTGGGCCCGTCGCATAGTCTGATGAATGAAACTTGAAAATTTCGCAATTCAAACCT
CAAATTTCGCCCTGGGCCAGTCATCTTTTCACTTGACACGCATCACCTGCCGGCCATGAGCGAGCTGTATAAAGAGGCCGCAGCTCTACTGGCGAAGCTG
GAAAAGCGTCAGGGCGGCCTCAAGAGTCTAGCGTATGCAGATTCCACAGTGCACAAGCGCAGCTCATTTGCGCTGGTGTGCGAGACGCTGCGCTATAAAC
CGCTGCTGAGAGAGCTCCTTGCGGCAGTGCCTGAGTGCCACAAGGCGCTGAAGACGCCCAAGAACGCCAAGGAGCCGCTTGCGCTCGTGTTCGTGGCGCT
TTATGACCTTCTGTTTGGCCGTAAAAA