Description :
From Genome Similarity Track
Location :
Scaffold_445:9319- 10787
Transcript NameFunction/comments
Hyaar_Emoy2814142hypothetical protein

Sequence
1468 bases(100 bases per row)
TTGCACAGCTAAGGAAATGATTACCAAGACACTGCTAGCATCCTGTGAAAAAGTTGAGCAGCACTGACTCTTTTTCTGTGATCAATGTTGTGCTCTAACT
TCATTTCATTGTAAAGACGCCATATCAAGGACAGGTGAATAAGTGAATGGGTGGATGGATGAATGTGAATGCGTTGTTTATGTGGAGGAATGTGCTTCGC
ACTTAGTTGGTGATGACAAGCACAGCGTTTCAGGGTAAAAGTAATGAGTACTATTCCTCGTTTGAGAACCTATAAATGAATGGGTAGGGTAATTCTTTCA
CCATCTCATGAGTCCAGGTATACTCGCTGTATCTGAGTCTGAGTATACGCTCTACTCGTGAAGTCTTGTAACATAATGGCGAAATTAATATAAAGACATC
CCAAGCTCAATATCCATCTGTATGTAACGTTGTTTGTCTTAAGGCTGCTATCGAAAAACGCCAAAACCGATGTGCCCTGGTCGAGGCCGTGTACCCTCGT
CTAGCTAAAGATTTATATCACCTTATGTCCACCAGCCTGATATTTCACTGAAATTCACCTTATGTCCACCAGCCTGTGAATTTGCTACACTTCCTGTTTA
ATCGATAAACAAAAGGAGTATGCAATTCCACTATGTCATATTGATCTAAAGAGCTAGACTGACTCCACTACCCGTGGTCCCATGTGTCATTAACATACAT
CTCATTCTTTGAAGCACTCATCCAGTGTGAAGATTGTCACTCGTCTGCTCGATCAAAACCGACTATTATGCTTGATCATATGTACGGGCGATGGCTGAGG
ATCCTGCGAGTCTAGACTATGCGAAGGGATACAGTGACTCATGCCCCCCTTATGGCTTCGAAAATTGGAGACATCTGATGAGCGATCGAAACTGATATGC
CTGCTCCGTATGCCGCGATACAAACGAAGAGTCTACTATCCCCCCTGTCTAGCAACAATATCTTTTTTNNNNNNNNNNCCCCCCCCCCCCTCATGGGATC
GTCTTGCGCAGCGTGCAATCTGTGATGCATCAATTTTGTCTGATCAGGATAGATGGTTGCGTGATTCGATGTGATCCAGCACCTCACTTATCGTAGTGCC
TGCCTCAACAATTTCGTGTTACAAGTGCGACATTTTGGCTGCACGAAGGATTTATTATAGGGAACCTCGTGCGTCACCATGTATTTGTTCTTTTCCATGA
TCTCATTACGGGTTTACATTGCTAAATGACGGAATTAGGAGCAATACAGAACTTAACGGAATTATTCAATACCAGTCAGGGCAAATAAAAATCATATGCC
TCGCGTGCACGCTACACGAGCGAGGTATTCATGAGTCCTTTGTGAAACAGACTAGGCGCTAGATCTCCGACGATCGAACAACGCGACGTTTACGGACTGG
TAGTACAACATCTTGCGCCTTGTTCCAGCGAATGAGGTGATTTCAAAACGGTCGAGTGTTGTCGAGTA