Description :
From Genome Similarity Track
Location :
Scaffold_55:93185- 98005
Transcript NameFunction/comments
Hyaar_Emoy2806757hypothetical protein

Sequence
4820 bases(100 bases per row)
TACTTGAGGCATCATCGCACCTATTCCTGCTTGAAATACTCATGCGTTCAAAAAATCCTGAAAGATTTCGAATTAATGAAAAACGACACAAACAGATTTA
ATGGATATATGAGGTCTATTAAATTTTTAACAATATACAGTTCATAGAGCTGAATAGCATGAAGCTAATATCTATCCTACCACTAAAACAACTACAACAA
CAGCCTTGCAGTAGAAAAAACACCACAAAACAGTAGTAACATGAAGAACAGTAAACACCATAGCAACAACAATAACAGTAGCAGTAGTACCAACAACAGC
AACCGCAGCAGCAAAGTCAAAAGCTACACAAGTAACAACACCAACAACAGCAGCAACATCATCAACACCAGCAGTAGAGATAAAGACGGCAACAAGCACA
AAAATCTAAATCACTTATACTACAACAACAACAGCTACAGCAGTAGAAGCTGCAGCAACAACGGCACCAGCAACAAAAACACTTGCAAATGATACAACAA
AAACAATTATAAAAAAATTACAACAACAGCTGCACCGACTCTCTATGCCTACGACCGCGGACGACGATATGTACACTTTTTACGTCTTTCGTCTTTGCAC
GAAACAAGTGGCAGCGAGCGCAGCACGCCTGCGACAGAACCACCTCCGGGGCTGCCCCTACGGGACGGGGGTTGAGCGCGGCCGTAGATTAGTTTTGAGA
AAAACGAAGATGTGGGTCTTTATCTGTGCTACGATAGCGTGAGTATACTAGGATGTGGGACCACTTTTAAATTTCTAATTATCTGGGCTATTTTTTATTT
TTGTGATTAAATGGGGCATTTATTTTTAAAATAAAGGTGGAAACCTTTACAGAACATCGTCGACTATCTACGCAGCTGCCAGCCCGAGCCGTAGCCACTG
CAGTGTATCCGGCTCGGGCTGGCAGCTGCGTACATAGTCGACGATGTTCTGTAAAGGTTTCCACTGGAACCAAGCACCGTCGTCGGGCTTGTCGTCGTGG
GCATCCAAAGGGAGAGACGTGGTGTAAGGCGGGATGAGACCCAACTAAACATGCCGGTTTTAGCCTATATTTTTATGGTTCTCTAAACTTTGCTTCTCAT
ACAGCAGAATTGTAGGAACGCGTTTTTATGCCAACACCGAGCCGTGTCATGACTGTAATCGTGGCCGACAAACGTACATCATATACGCGACGCCGATGCA
ACGCGTAAACGAGATGAACCCCGCCATCAAGGGTGGTGGGCCAAACGTAGCTGATTGCACGGCTTATCGAGTTGGACTGCGGTCACCGGAGCACGCGCGA
TGCGTGGGCACGCCCATTGGTCGTAATATCCCCATTTAGGAACCCGCCATTTACCACGGTGAACCCCTTACTGCCGCTTGCACGACCGATCGACGTGGAG
TGCAGTCGCCAAAGCAAGCGCGAGTCGCGGGGACGCCTACCACCCATAAGATCGCCGTCTAGCCAACTGGTCGCGTGACCTGCGGCTGTGCCATACTTAT
ACCTTATAATATAGCCTCGCCCTCTTCGGTTCCCGCTTGGGTGAATACTCGCCGAAGGACTGCTCGATATAGAGCTGAGGACAGGATTGGATTAGGCGTG
GATCCGAAATTAAATACGCCAATCACAGAATAAAGAAACAGATCGTAGGCAATACAACACGTATCATCATTGATCCATTACGAATCTCGGTAATGGAATG
CATTAAGCATCGGGTATGCCTCAAGGAATAAGCTTTCATACAAGGTCGGATCGCCGACCTTTGCATTCCGATCAGAATCATTAGTTAGACTGCTCTCGGA
CGGCTTTGTATCGTATCTTGTACGACCTAGCGATCTGACGAATACGCTTTACCTGCTACCGCAGAGGCCGTTTGAGGGATCCCTTCCTACCTCATTCGGC
AACCGAGTGCATTTAAGGATAGAGACGATACCATTACGCGAATCCAAGATCCACAGATCGGCACATAGCATATCTATAGTGGCGTCGCGATCGAACAAAG
CGCGGTGTAATCGATCGCACTCAACGCGCTTGGCTTGTAGAAAATTTAGACTTTGGCCGCATTCTTCTCCACGCTTGAGATATGCTCAACATGACAAGCG
AAGCGACTACTGCTTAATGAATTTATTTGCATCAGTGTCGAAACCGTCAGGATCACGTCTGTCGTCACGCCATGTCGGGCATTTGCATCACGAGCAGTAG
GATGTGCGGTAGGCTGCACGCAACATTATAGGTACTGTAAAGGTAGGAGCAGAGTTTAGTTTTGCTCCAGTGAAGAAAAAGACTCCCGACATTCGTTGAT
ACAACCGTCGTCACCGCCTTTGCACCCGCTCCATCACTGAGTTTTCGTACGTTAAATGATAGGACGATATTAAGTTCAACTCAATTTTTGATCTACGTTA
CTCTCTTTTGTATTATATTCAGCATCTGTGGCGCTCAATACGCCCGGAATAAATTGTCCATACGAAGGCATGTACGTGGATGAGCCAAAAAAGTAGTACA
AGTACCATTTTTAGTTATCATGTTTGCGCCGAACGATTTTTGGTTGTGCTTGATTCTTGCGGTACCTTATTCATGAGGAGCGCTAAACCGTTGGTCGACT
GCGTTACTATACAAAATTTAAGCATGCGACGTCGCGCCCACCCACGTCCACCTACAAATAGTCGGTCGCACCCATGACCATAATAACATCGGCGTGGGTG
GGCGTGGGTATAAGTGCCTGATTTAACACTCTGCTATACATCCATCTCGAGCTCTTAATGTCCTAAGAGAGGTATTGGGTGTGACCCGTTTAGAGCGATA
TTGATAATATCTTAATATTTTATAATATCGTACATTATAGGTTATGGCTCAAGAACTGAAGTATTAAGTACGTCATACTTAATGACTCACTAACGTGTCT
TTAGTATTTGGCATACAAAGAATAAGATAAGGGAGAAAGCTCTGGAGCTCGCCGTTTTGATATGAGTAATTCAGTTCATAGAACTGGATCAAGTCCTGCA
TTATTAAATAACTTGCGGTCAGTCACTAATAGCTCCACCCTTCGGGCTCGCAATAATGCCTATAACCAACGAAGAGGGGATAAATGCTTCATCGCAGTTA
TTACGACATTTAGAGTACACCGAGCGTTTATCTGCAGACACACGCAAAAGAGGCGTCAGCCTACATCGCGTTTAGTACGACTTGTAAGGTACGTCTAGCG
TTACTCACAGACACAGTTAGTCACAGACAACATCGCCCTTAGTGCGACGTGTAGGTACACCTGGCGCTATCCACATACAAAGACAATGACAGACTAAATC
GCACTTAGTACGACATATACGGTACACCTGGCGTTATTTACATACACAGGAGGTAAAAGACTAAATTGGACTTAGTAAGACGTTTATGGTACTCCTAGCG
TTACAGACACACACAGAAAAATAAGTACGAGTTAAAAAGCTCGGCATTCACTTGCGCACAGTAACTAATAGCTTCACCCATCGGGCTCGCAACTATAGTA
GTGCAGTTATCCTTAGTGTAATGTAATAGGAAAAGGGTTTATTCCCGCAGATGAATCATAACTATAGTTCAGTATGCCTTTGAGTAGAAGAGTACAATTC
TTACTGACTTCTTACTCGTCAGCACTTTGTGCTGTTAGTTCCCTCGGGACTATTGAATTTTAGCTTGTTGACTATAGAGTCTTACCTAGTTCGTTAAAAT
GGGTATACTCATGAATCGGATCCTATTAGTTTTCATAGAACTAATTGGCTGTAATCCAAATTCTTCCTCCGACTAAAGCGCTGTGAAGCTCTGTTACAAC
GAGTAAATGCTTCCGGAACGAACATACGAGAGTGTTTCCGTATCAAGGAGTGTGCCTTCTGGCCGCTCACTTAGTCCTTTGAATAATGTAATTATTTTTG
CCTAAAATATTAGCTAAACGCGTATTTTGCTTTAGTTTTTGGATAGCAGTGAGATGAGAATCCTAATTCCATACATTTCTGACTGTCTGAAAGGCGCTAG
AACAAACCGCGAGTATTTTTGCTAGCAGTTTCTATACTAAAATTTAGGGAAGTGATATCTTCCTCTGTAATGAGTGTGAGTCAAATCAAACCGAAATGCA
TTGTCGGTAGCCTTCGCCGTACAGTACCAGTCAGAGAAAAGAGATTACTGCTGCCAGCACCAGCGGCGAAGAAAAAACAGGTTGAGTACTCGTACTTTAT
CATCTCAGAGAAGAAAATATTTTACCAAATTTCAATAATTATGGTGACCATCAATTTGCAGATCTACGCATGAGTCTAGGTCTATTAGCGAGAGCAAAAA
CCTGGACAAGAATTTGGTGAGCAGGCGTCAGAAAAAAGGAAATGAACAGAAACTAGGCTCAATGCAATCTATACGAGGGGTCAAAAGAGTTCTATAAATT
GGTTAATGACATTTTCTGGCGCTTTGTGACGTGTAGACACGTCACTAAGTGCTACGAAACGATGCGCCAACCCATATGCGGTTTTGAGAGCATACAAAAA
GATATATATACCTTTTAATGGTTTTGGTGTAATTTGATTAACAAAAACTTCATTCGTGATTCACCCTACCTGTCACGCTGCACGCTTGTGCTTAATCTAA
TTTCAGCTCTGATTGCACGATTTGACTGCAAGTAGGTTCTACTGCTCTAAACATGATAAATCACTAGAATTTTTACTGACTCTTGTATTGTGAAATAAGG
ATTATCTAATTTGTACGTTAATTGGTCACTTATTCTACCCTCAACTCCAAAAGTGTAGCTGTGTTCAAATGGTAATATTGTGGCCCAGACATTTTAAATG
GACCAAATGACCAATTCGGT