Description :
From Genome Similarity Track
Location :
Scaffold_379:93183- 95317
Transcript NameFunction/comments
Aphin_H310_07013Hypothetical protein
Aphin_H310_07014Hypothetical protein

Sequence
2134 bases(100 bases per row)
TCTATCACGATGTCTGCGTCGTACCAGGACTTTCTGTCGTAGCATCGCGTTCTCCATCTTCAAGAGCCCGACCTCGTCCTTTTCGGTGACGGACAGAGGG
CGGTGCTGTCGGTGATCGCTACTCGCTGTCGAGGATGCTCTCCTGCCCTCATACGGAGACGACAAACTCCTTCTGCCTCCACCTTCTGACGCGGATGCCG
CACGCGCCACAGCTTCACACGGCACCACTTCGTCTTCTTTCAGCGACATCCTTCCGCCGTCGTCGCCGGCCGTCGACATTCCGTGCTGGCGTTACGAAAC
GGTTATCCACCTTGACATCACCAACAGTTTCATGATCAAACGCGATGCGCACGAAACCTGCCTGCCTTCTCGCGGCCACAAATGGGCAACAAAGGCCACA
ACTTTCCTGGCTTGCATGCATCGCGACTGTGCCTGCATGTGCTCCACCGGAGCAAAGCGATGTCGGCTCTTCGGGGTTTCCTGGAACTCTTTGCATGGGA
CGACCGACTTTTGCACGCGATGGGGGCGATATTAGCATGTATCCGACAACCGGGCTCGACCGAAGGCCCTGCAGCGGATACCTGTCATGACAGAGTTGTG
GAAATGCCGAAGGGCTACATCCTTGAACATCGACGGGCGAGGACATGCTGCGACTAGCGGACGAGACAACGAAAGCCGCATCCTTCATTGACAGGACACA
GCAAAGTCTCAGGCTTGAGCTCTGTACACGACACATGCACAGAGCTCCGGCCTGTGTCTTTGCAGAGATCCATTTTAGTTTAGGTTGCCGTAGAATCGAG
CGCAGCTGGGGTTCGTGAAACAGGCACTCAACCACTGCACGTTTCGGTGACCATAACAGACTCGGGTCATCTGGAAAGCAATTTGCTTGGAGCAGCTTGC
TCGAATGCAGCGGATCAGCATTTAGCACTGGAGCATCCGCAGCGCAACCCGAGCAAACGAGCTCATTGTGAAGGAGTGTGTTCAGGCGGGCAATGGGCGT
CCGTACTCTGCAACCTGATTTGACTTGGAAGCGGAGTTAGTCGATTTTAGCGGGTTGGACCGTCATGCCTGGACATGGTGCGCATATTACGGATTAGTTT
CTAGTTGTGGTAGTCGACAGTCGCTACCCAAACGCAGCCACGATCTTGGTGTCCCCCGTCTTCATGTCGACAGCGAACTCGACGCCGTTGCACATGGCCA
TCATGGACGTGCTGAACCCGTTCCCGAGCTCGTCGGAATCGCTTGCTGCCTGCGCCCGTTGGACCATGGACGACAGAAGCTCCTCTTCTACGACGAGAAC
GAGGCGCTTGATGCGTCCGCGCTGGACAAACAGATCGTACGCCAATTTACGACGCATCGCGCGACTCGCAAACTGATCTTCACCCAGCACATGACGCCCA
AGGAACACACTTTCACGCAGCGTTCGCCCGTGCACGTGCTCGTTGATGCGCTCGGCAAGCAGCCGACTGCCGACTTCGCCATTGTGCAGCACCTGCACCT
CCGCCCCCGCCAGCGCGTTCGAAATGTACCGCGCCGCCTTTTTCGAGTACGCCGGTTCGTTGTCTTCGTCGACGGACCGCACGACCCACACGCTTCGCGT
CTTGCTCTCCTTCTTCTTGGCAGCTCCGTTGCCGCCGTTGGCGTCCGCAACGTCGACTTTCATCGCCATGGCCACATGCAGCATCCAGTACCATTCCTGC
AGCAATAACTCCTGGCCTTCTCGCACGGATAGCCGGACCATCTCCTTTTGGGTGTGTGCGACCCGCAGACTCATCGACAGCGGCGACAATATCTCGACCA
TGATCCCGGTCAACGCGACCGGTTCGTTCCCTTTGGACTTTGTCTTGTCGCGGCAAATCAGCATTTCGTTCGGGTACAATTCGCACATGGTGAACTTGGT
CGACGGCATTAGAGTCCACCGTGTCGTCACACCGAGCTCGCCCGACATCAACATGCAATTGCGCAAGTGTTTGGTGACGGCGTCGGAGCGCGGGAGTTGG
TCCAGCACAGGACATGGCAGTTCCTCGGGATGATACAGTCGGAAACTCGCGCCGGAAGGGTACATGGACGGCCGAGACGGCGTTTGAAAGTATGTTTCGG
TCGAAAACTCTTCAATCATTTGGTCGCGAAAACG