Description :
From Genome Similarity Track
Location :
Scaffold_7:931540- 934090
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05316hypothetical protein
Phypa_INRA-310PPTG_05317protein phosphatase 2C

Sequence
2550 bases(100 bases per row)
ACATTATACTGGTTGGGCTACTCCTCGCTACTGCAAGACGCGTTGAAAGATGAAGAAAGATTGCGAGCTGTTCCAGGACACGCGCTGGTGAGGCAACTGG
TGCAGTAATTGAAAGTGTGTTGAGCTTTGCAGGGTGTCCTTGTAATCGATGACAAGCGTTCCAGGCTGCAGTTCTGCCTCCAATTTGTGCTGGACCTGCT
GGTACAGTGTTGCATCCCAGCACTGTGACGTGAGGAGTAATATCGACGTCTCCTGTACCGATACAGTGAGCATGTCAGCGCATTTGAAACAGCATTTGGT
CTTGGGAATTTGTAGATCTTTTCGTGTTTGCTCGGCCAAATCGTGCAGGAATTCGAGGATTTCGACGCCCGCAGAACGGAGGCCAAGTGCGAGAGCTGCG
AAGAATACGAGAGACCCCGATGACGAGCCGAAGACAGTAAGTGTCGCCTGTTTTGAATCACGTTCGATTACATCCAGCACTGGTTTTTGGGTGAAAAGGT
TCAGCCACGTTGGGAACGGGGTGCTACCATAGGCAAAGTTTTCTTCAGAATAGCCGGTGTCAGAATCCGACGACTGCCGCTGGGCTTTCAGAAGTCCATG
GTGGAACTCAAGCTGCTGCTCTTGCTGTCTCAACCTCGTCACTAGTAGTTTGAGACGCTCCTTGTTAGTAGAGTCGACGAACAATAAATTATGGCTTGCC
AAAATTTCGTTCATTTGAACAACTGCAGCAAGCTCGTCTTGAACTCTTCGAAAACATTCTTGCTGGATGCTTTTGATCGTTGGGATTTTGCTTCGAGTGC
GGGTTTGAGTAGCAACCAGCAGTTCCGCGATATGTTCTAGTTTCTCCTCAATGACATCGACAGAACAGCAAAACTCTTGTTGATCCGTTCGTTCATGATC
GCTCTCAAGAAACACGACATTGATCGTTTGTCGAAACTCTTGAAGGCATGAAAGGATCTTCAGCAGCAGAACTCGCAACGTACGTTTGTCATCAGAACGA
GAAGCCTGATCCAGATTACTATGAACAAGGTGAGCGGCAGTTTGAAGCTTGGAATACGATGTCAATAACGCTGCAGTCGTAAAATCCGGATTCAGTATTG
TGATAAGGCCTCACCTGCTTGAGAATACAACCGCTCTCCTCCCACGTCAAGGGTGCCATTTTTCGTATCCTGGTCGTACGTGCTGCGACGGTTCGAGAAG
CGTTGTCTATTATCTAGGGCAGTTTACGTACACTGCCATCGCACATCTGCGATTTGCTCATATCGTCGAATACGCGTAAGTCAAAGAAACACCACGATTG
CTGTAACGTTATCGCCGCTTCCTCTTGCCAAAGCCTCCTGGACAAGAATTTGGGCTGCACGAGACTGCTCGGCGACAGGGATGGATCCCATCATGTCCAC
AACCTCTTGGTCACTAAGGACATCCCAGACGCCATCGCATCCCAACACGAAGAACGGATAGTCTGCCGCTGGCGTTAGACTGGCAGAAGATAACGGGCAT
CCAAACGACATTGTGTCAGGTTTCCATGGCGCTACGTTGGTATATCCAGTATTTCCTTACCGTGTCGCGCTTGTGTGAGGTTTCGCGACGACGAACTGCT
TCAGATCCCTGTCCCCAAAGCTCCTGCAAACAATTTCAGCCAGATTAGATCGTTGTACCAACACAAGACGTCTGTGGTGTGGGAATTACCGGGAGACCGC
AAGGATGCCGGACACTCGATCTTGAATGACGAAGCCACCCTGTTGGATAATCCGCTCATTCTCAACGTGATCGCTAGCCTTGTGATCCTGCACACAATAA
CGATATAACTTCACCTCTCTGCAAGACAAATAGGTTGCTAACATGAACATTATACCCCACCTTGGAGAGTCTAACTGCTTTTCCATTGCAACTAATGACT
GCACGGCTGCAAGGATCAAGAGCAAAGTTAATGCCCCGTCATGCCTCGCCCAGCAGAAATCTACGCACCTGTCACCGACGTTTGCGACGTAAAGAGTTTT
GACATCCTCCTCCTCCAGAAGTATTGCAGTCACTACCGTAGCGCCAACTGACCCCGAGAACGACTGACAGCACTCCATGTCTGAGATAAAGAAGCCCCTA
CAAGAGCAGCAAACTCTATCAGGTTATTTCATCTTCTTTAGAATGTGAAGCAAGCCTAAAAAACAATACCGCTCGAGCCGCTGCTCCACTGTACTGTCGT
CGTCCGCATGTTGTAGCTCATTGGCAATGTTCTCGTGCAGAATACGTTGCAGGTACGTCGATACCGAACGACCTAGACACGTTTCAATAAGTCAGGCGGC
TACCCACAGTAGACCACTCGAGAGACAGCACATACAGAACAGTAAATTCATTACACGTACCTCCATGCCCGTCATGAATGGCGAAGTAGCCGTTCTTGCG
ATGTTGCAAGAATCCGTCCACGACGCGAACCGTGTCTTCCATCGTCTTCCGGTGCTTCGCATTCTAATCACATCGCGTTCACAATCAGTAAATCTGCTAG
CAACGTCGCCTAGTGGGCTATTGTGGTGCTACGCCCACCATTTCCTCACA