Description :
From Genome Similarity Track
Location :
Scaffold_10:93150- 102735
Transcript NameFunction/comments
Phymu_g798tRNA wybutosine-synthesizing protein, putative
Phymu_g799hypothetical protein

Sequence
9585 bases(100 bases per row)
AATTGGGCACGCAGTGAATGTCGGCGACAAGGTGGTAGACCTTCGGGGCGTACGACTTGACTCTTTCGACATGCTCACACGTGATAGTCCAGTGCTTGCC
GTACTGTTTGGCAAGAGCTCGCATCGAgtccagcacgtgctgctccCATGTTTCACGTTCCTCAACAGCCACGTTGTCGTGCACGTGGAACCAGCCGCCG
CTGGGCTTCATCACTTGCACAGCCAATGGCCAGGCCTTCTCACTTGTAGGCAACAGTCCCAGATTCACGCGGTCCGCCACTGCACCGATCGTCGGAGCCG
ATTCGCGGTTGTCTCCCAGATAAACCTTGCACCTGTCTGCTACGTGGTTGCGCTCCAGGTTGAAGCGTAGTGCTGCCACCGAGTCCGGGTTCCACTCGCA
TGCGTGGACAAACGCAGCACCACCGTGCACGAGGAATGGGAGAACATAGTAGCCGATGCCGCAGAAGAGGTCGACAATGGTCTCGCCACGACACCCGATA
TTTGCCATACGGGCTTTCTCGGTGACATTGCCCGACGAGAACATCACCCGCGTAAGATCCCAGCCGTAAATGATCCCATTCTCGCGGATCTCCACCCAAC
CAGGGGTCTGCTTGCTACGTTGCGAGGAGAGCGCCTTgtcgttcacgtacagcagctccacatgGCTCTGACGCTTCTCGCTTGCGTCAATATAGGCCTT
CCGCGCAACACGAGAGAAAGCAGGAGTAGTGGAAGTACAAACGTGTGCCCACATCTCGTCAGCAAACGGCGCCCACTCCGGTTCAAGGAACGAGTCTCGT
GGGATCAACAATACGTCACTCACGAACTCATACTTGTCTGGAATAACCTTCACGATCTCCGGTGACAGTCGGTACTTGCTGGCGAAGACGTCAATTGTGC
TGCGGATCACTTCATTACGGTTCAGACCACTTGTCTTGCCGAATTTGTTTGCGTACGCATCGTCATCTGTCACAACCTCGAGGTGTTGCAGTTCGGCATC
ACTAGTCGAGACAATCAGTTCACGAATAGTTGCTGCCACAGGAATCAGGAACATCGTCGTTGGCTTTTCATCTGTTGTCGCTTCGTTCGACTGCGCGATA
TTAGCAACGTGAACACGGCGCGATTTGTCATACACgtgcgccttctccagtagtgtcttcaccttcttcacttgcagtTTTCCAACGAGAACACCAAGTG
GCTTGTCATCTGAAGAAGCAAGCGCACTGCTAGTACTCGTGCCGACTAACTTAACAACGGCAGCGGTTTTCTTCGGTGCAATCACTGATAGCTGGCATTG
ATAGGTCGACGAGTAAAACTGCCCGAAGCCAAAGCATTGGAAGCCGCCGCCCAAAATGTAAAGAGAATTGTTGGCCGCCATCCAAATGACGCTGTGTCCC
ACGAAGGCAGCATTCTCGTGCTTcacttctccaagctccaTCCAGTGAGAAGCATCGACATCCAGCATGTACACCTTGTGTGTCGCTTTACCGCTCTTCG
CGACCAACGCAGACGCCATGCCACCCACAACTATAACCTGGTGATCATTGATAGGggaggcgctggctgcgAAAAGCGCAGGAGGTTGGCTTTTGTTCCT
CGTGTTTTCGAGACGTTTGTGCCCCCAGGTTTCTTTCAAAGTATCAAACAGCAAACATCCGGTGCTAGAGCTGTCGACATCACTGTTAACGCTCCCTTCT
AGTGAAGACATGCCTCCCAAAAACACCAGCTTGGTCGAGTTGATAACTGAGCCAATGTGATCAAACCGGCTCGAACCAGACGGATTCTCTGCAGTTAGCG
ATAGCAAAATCGATGAGCACAATGGAGATACGGATAGAGTGGCTGAGAAGCTTACCAATTTGACGCCATTGCGGAGGGGTCTGACTTAGATCCAGAGCAA
ATAGATCGCCAAAAACTTGCTCAGCATCCCGACCTCCGTGCACGTAGACAACGGAACCAACTGTGGCAACAGTGAACAAAACAATCAGTCAAACTCTGAC
CCGCAATTCTCCGTTACCGGCATGTAAAATTGCTGTCttactggagcagctgcaatGCTTCCAACGAGGAGAGGGGCCAACTCCTTCCGCTGCAATCTTC
TCCCACCGCTTCGTCTCAAGATCTATAGCGTAGAGGTCACCCAGGGGCTTCGTGGGACTAGCTCGACCACCAAAAACGATCATCCGCGTTCCTACAACAA
CAGCCGAGTGATACATTCGAGCTGATGGGCCATCTGCTCCAGCCGAGGCATGGAATGTCCTTTGAAGTGTGCCATCACTGGATGGGGTAAAGCAAGTTAC
GTCTGAAACGCGAGTTGTTGTGCCCGAGGAGGTGGGTCCTTGGCCACCGAACACGACTATGCTGTCCTTGTATTGCACGCTTGAATGTCCCACGAGCTTC
ACACAGTTTTCGCTGGTTACTTCCGTCCAAGACCTCAGTTCAACCTGAGATCCCCTCCCAGCGTTTGCTTTCTGCTCGCAAAACTTCGTGCGGAAGGCGT
CAAACAGTCGATCCGTTTTCTGCTTGTTGGCTTCGAACTTCTGGTTCGCAACGTCCACGATCCACCTGAGGTACTCTTCATTGACGAGCAACTGGTCCGC
GCTCCGCCCAAGTGGGATCTCTAATCCATTAGCCGTCGTACGAATTGCGCACATGATTTTTCGGTTGCCAAGCACAACGCCGGATTCACGGAATCCACTG
GCGATTccccactgcagcagttccttcGCCGCATCCAAGTCACGGCACACTACGTGCATGATGAACGGCTCGTGCTTGAAGATAATCTACAGCAAAGACC
ATAAAATAAGATGGAGAACAATTTGCAGAGATTTGTGACCAGCAACGCACCatgttgctggtgctggaatTGGCGTCAGATGAGCGCAACGTTGTCGCCA
ATTGGTCGAAGGTGATCGTGCCGTGCTCAGCAATCAACCACTTGCCACCTTTGGTGATCAGATCCGATTGACCTTCTTTCCCACTGCCAACCGCAGCTTC
ACCGCAGAAAACCGCAATGCGACCCGAGCACGAACTACTTGTCACCTGTACGTGTGCATcaaaagtatttttttaagTATTAAAATACTTCCAGTGGCAT
TTAAAACCAGTTAGCAACGCACGTAATCCGGGTGCGCATTAATAGTCTTGATCATGTCCACGATGGGTTCATCGATGCAGCCCTTGGGGCTCTTGTCCTC
CATaacctgcagcttgcgcagactctcgcgcttgagctgcgcgAACATGTTCACCTCCAGTCGTCGACTGACGCACAAAATAATAGTCTATAGTCCAGCT
CAAATTATAGTCTGTTAAAACCATTTTAGTTCAACTTATTATCCAGCAAAAAGTAGCCTACCGGTATTCATGGCTGAAGAATTGCCGCGGATCCGCGTGC
GTTGCGCCGGCGTGCGCACCAACCACAGTCCGACGCTGCCAGTGGACAACGGGCGCGTTTTCTTCAGTGAGTCGCAGTACGCGTCGTCCCCTTATATTGT
GCGCGTGGCCTTCGACAGCGTCAGTTTCGTGCATCGCGGGACACACGTCGTGGAGCGGCGTTTTGTCTTCCCAGGGCGCGTTCTGCACGCTGTGCTCGCA
GATTTTCCTCATGAACCTTTGAATACCATAACTAAGCGTTATGATAGGTCTCCGAGAGCTCAACGAACAAGGAATGCGGCTCTAAAACCTCACGTACACC
CTCATTTATGCGTGCTGGTGCGCTCGGACTGCTTAAACGTGTATACTGCAGCTGGGGAAGTGTTCGAAGTGGCTCTACCTTTCCAGGCCAATAAACTATT
TCCTATGGAGAAGTGGggtcttctgctgcagcgcagccCAGCGGTGCCGATCCCTTCGAACACGCCGTCGAAACGGCCAAgggatgctgctgctgcagcg
ttggctAGAAAGAATAGACGtgcaagcaccagcaacagaGGGGATGGAGACAGATACAAGTACAGCTCTGGAGAGAAAGGAACGGTATCCAGACCGCGAT
ATTTCACACTCAGGCATCCACTAGATGAGGTTAAACCAGTGGCCTTGAGTTCGGTGGGAGTTATGGCGAAGAATGGAGAGAAATTTCTCTCAGATTCGGC
CTTGGAAGCTGTGAATGTGTTGATGGATAAACTGTCACCTCTTTTCGTGGTGTTTCATCGATGGGAGCAGAGATTTTGTGTGTTCCGGATGAAAACAGTG
GAGAAAGTGACTAATTGCTCGGTACCCGACGTAAAAGTGGTAGATGggccgacgtggacgagataTCGAACCAGAAGTGACCTGGAGGAACTCCGGTTGC
GGATTGAGCCTGACTGGACGGTAGGGATGCTGTGGAAGTCCCCACGGGTTGGCTCTCTTCCTTCGAAGCCGATGTTTCTGTCGCCGATCGTCTCGCCTCC
TTCACGCTTAACTGCTTCATCTGTTCCGCCGTCACCGATAATAACCCATGCATCATCAACCAATGCTACCAAGGTGTCATTTATTGCGTCAGGTGTCGAT
GGGTTTCCGGTGTTGTGCATAATGGATAAAGACGCTGGAACGCTTCTTCTGAAGCCTGTTTCACAGAAGGACAGCGCTACGCTAAGTCTCGACGAAGGTG
GCAACGAAGTCGGGGGTGTCTCTATCTTGCGCTGTCGAGATGCTGTTCCAATTAGACAGCAGAATCACGGTAACTTGTTTGGAAGTGGCGAAAGCCAAGA
CCTCGAGAGTTTCCCGGATATCGTGGTGCTAGAAAAGGATGGCACACTCGTGCTGTATAAAGCACATCAGccagtctgcagcttgacTCTTCCGAATGTA
GCGCAACGGGATCTCGATGTCGATGGCGTGAATGCGAGCGGTTCAGAAATTCGACTAGCCTCCAATGTGCAGCTGAACTCCATTGACAGAGGCTACGCGT
ACGAAGTCGTATACCCTGACTTGTGTGGTAGTagcagcaggaagatctGGCGATGCGAGCATCCTCTGAAAGTTGTGGCCTCTTCGCTGCTACAGCAAGT
TTTTGATGTGCTGGATTGTATCGTTCCTCCCACGGAGATGTGCGCGTTTAAGGCGCACATCGTTTGCTTAGCACAACAGAAAACTAGAAACTCTGCACAA
GCTGATGCCTTCATGGACAGTGGGTTTGAATGGCAAGCTTTCCGTGGAGGCATCCTTGATCTGCTGTCTGGTGGCAAAGATGAGtccgcagcaacaggaa
ctgcTCATGACCACGAGATATCTGCTCCTTCAAGCCTGTCGTCTTTTGACGTACTTTGCCAAAGTGAATTCCATGGCATGTACCAGTATGAACATGCGAT
GCTTTTCGCGACAATGGATCTACCCGTCACAGAGTCGAACTCCAGCGACGATCACTCCACGGGTCAGAAGATTGTGCAAGTGAACGACAAAAGGCCTTAT
TCCAAGATGGCAGGGTTAATTGAGGCCATATTTGCCAGCCTTCACTTGTTATGCGAAGAACTGAAGTTGTCAGTCGCGCTTTACCGAGAGCGTTTGTTCC
TGGTGGAGTTGCTGTTGGAAATGTCGGTGCAATTGGGACTGGATCAGTTTACTGCGTACTATGAGGAAGATAACTGTATCCTAAAACGTCAAACGAAGCG
GATACCTCGAATTacggcgaagaaggaagatGGAAGGTTGCTTCGCTTCGCAGAGTATGGAGCGGTACCGGACTTGCTCGCGTGGCTTCAAAGCAAAATG
ACTGCTAAAGTACAAAATTTGCCAGAGTTTCCCACGCTGTTTGATGCCGGACAAATGCAGAATCAACACCCTGAGAGTCCACTTCGGCGCTCTACAGCAA
TTTGTCGATTGTTCGATCTGCTACATTCAAGTTCAAGCGAGGGAGAGTCGCCAGCGTTCAAGCTGACCGTTTACCTCACTCAAAGTCCTATTGGTAGTTC
TCTCTCGTTGGACGATCTTCCGGTTAGTTTAAGCTTCCCTATCGTTCAAGCCATTCGTCATGTGAAGCACCATCCACCCCCTACTATCACTGAAGATATT
TGTACGTTTGTGGGGCGAGAAGACCTCAGTATCGCAAGTGCAGAAAGCCTTGCGGACCATTTTGAACATCCtgatcaccagcagcagagtgtTCCAGCAA
GCAAAACTGGAGACTCAGAGGATCTAGGACGCGATGACTCAGACGGTTTAGAAGACATTATCAGTCGAAGTCAGCCACTCTTCCCTGCTGATCAGAGGAT
GAAAGAAGTTGCACGGCTGCTCCGGTCGAGTCGCCCTCTGTGCTTGAAATTAGAGAAGACACCAGATCTGTCGGATCTCGACTacgcgcagcaacagcaa
gctCGTTTGTTGCTTCTTTGCAAGCGATCTATGGCGTTATCTGTGGCACGTGGCATGGTTACATTGGGCAGCTTTGATGTGTCTACAGCTCAGACTCGAA
TATGGCGTCTTAATATCCCTGCTCTGCCTCTTCAAGGGCGTAAACCGCCGACAAATGCGATAGTGGAGCTTGATCTGTCTGGATACGCCAAAGAATTGAC
GTATTGGCCTCAATTTCACAACGGATGCGCAACAGGACTTAGACTGCCAGCTAACGATCTCTCGGGGGTCATTAACCGCCACTGGATCAAGTATCATCGG
CCGTCAGTGAACGACATGTCGGCTGGAGAACAGCAAGCATCAGCCCAGGCGGCTGATACAACTGGTCGCAGTCTGGAAGAGTCGTATGCTGCCCACGCTG
GGTTGTTACTTGGAATAGGCTTGCGTGGCCATCTCAAGTGCTTGTCCATGGCCGATGTATACAACTACCTGTCGCTGTCAAACGAGTTCGTGACCGTTGC
AATCATGCTAGGCATGGCTAGCACTGCTGCGCACAGTCGGCGTAAGCGAACACAGCACAATGCTGCAACGAAGCCGGATAACAACGAAGAGGAAAGgaac
gaagacgctgagATCCATTTCTTCTCTGGATTCCCAGAGCTGGCATCGTCTGACAAAACTCCACTGCTTGGAACGGGCTTAGAGTTGGCGTTGGAGCGTT
CCGTATCCAAGATGCTCTGTCTTCATGTTCCGTCCCTACTGCCTTCACCATTTGGAGGGTTTTCCGTACCTGCATCTACTCAGACGGCAGCTCTACTGGG
CCTTGGAATCCTGTACCAAGGTACTGGATATCGTCTGATgacggagcttctgcttgccgAGATCGCCCGTTCCCCGTCGAGTACTCAATTTGTGGGAAGT
AACAGTAACGCGGGCTTTTCGACAGCTTCGTTTGACCAACTAGAGGGTTACGCTTTAGCTGCAGGAATGGCACTGGGTCTTGTGGTCCTTGGACGTGGGC
AGACCACAGCAGGTGACCCTGGACTGGCCGATctcaagctggaggagaagcttcaCAAGTACATTGTCGGTGGTGCGCAGCAGTTTAGGGACAcaaatgc
tgcaggaagcTGCTTGTATCGTGGTCGTCGTTGGCAGGCGTTCGGTAGTGGCGGCAATGGCTTCAACTCCGCTCCTAATGGCAGTTCCACAGGCAATGGA
ACATCTAATGGCAATACCGAAGGATCTCCCGGTGCTGGTCGCGATACAAAACATTCAAGTGAACGGAACGGggctcgtggtggtggcgaaCACGTGAACG
TCGGTGTAACTGCGTGTGCAAGTGCTCTTGCATTGGCTTTCATGTACATGCAAACCGACAACAAGGCCGTGGCAGCACAACTGGCGGTTCCTGATACATT
GGTCCTGTTGGACTACGTTCGCCCTGATATCCTGCTAGTACGCACATTAGCCAAGAATCTCGTCATGTGGAACGACATTTCGCCGACAACGGACTggatc
gagcagcatcaagtccctgcgcagcttcttcaagcgtACAAGTCGATTCAATCGCACAATGGTGATAATGGCTCATCTCACGTTGATCTACACTCAATCT
GTGAAGCGTACGCCAACATTATTGCAGGTGCTGCCATGAGCATTGGGCTACGGTTCGCTGGAACGGAAAACTCTTTGGCTAGAGCTACAGTTCGCAAGTA
CGTTCTTCACTTCCGTGAGCTGAGGGCGAAgacttcgtcctcgtcagTGCTTTTGCAGGGAAATACCAACGCGGTGGCTACTGCAATGGAACGTGCAACT
GTCGAGCGCTGTTTAGCTGTGTGTGCTCAAGCACTAGCGTTGGTTGATGCTGGGACAGGAAATGTGGAAACTCTGACACTGCTGCGCTCAATCACATTAC
GACAACGTGTGGACGCGGCCATGAGCTATGGCAACCACATGGCTCTGAGTATGGCGATCGGTTTGCTTTTCTTGGGTGGTGGACGTGCCACGGTTTCTCG
ATCAAAAGAAGCAATTAGTGCGCTTGTGATTTCTCTCTACCCGATGCCTCCCATGAATACCGCGGACAACAAATACCATTTGCAGGCGTTCCGACACTTG
TACGTACTGGCGATTGATACTTCACGCCTACTGGAGACTGTGGACGTGAATACGAAGACGAGCAGTGCAGTTCAAGTCCGAGTTGACCTTCAGTTAAGTG
AAAATGGGTCCCAACCACCGTCTCGAATACTTCAAACTCCGTGTCTTCTCCCAGAAATCACGACGATAAAGCGCCTTGTTATATCGGATCCTGAGTTTTA
TCCGATTGAGATTCTTGCGCCGCCGTCTGACGAACGGATTTATGTGGAGAGTGGCAGCATGAGGACAGCCAATTCCCTACGCTTGGAACTCTTGCGAAAC
AAGAACGTAGTGTTTCTAAAGCGCAGCCAACGAAAGGATACCGAGGGTTTTGCTAAAGggcagctggagcaactACATGGCGTGCATGTGGGTCGCCATG
CCGCTGCCAATCACGATGTCAGATTGTGGAGAGTTTTTCGCTTATTTTTCAAGTCTTGTGTTATCTACGATGACGATGACTttggcgacgaggaggacga
gattGGGCAGTACGATGTGGCAGATTGGGGCAGCAATTGGTGGGCGTATCAGCTGAGCTCACGAGCGTTCGAGCAAGTTCGGGAGGAGGTGCAGTTCTTG
CTACCACCGTATCTTAATGCTCTACACGCACTTtttcgactgcagcaagtgccgCAATTGGCAAGTACTACGGAGGTCGTCGACTTAAACTTGCTCAGCA
GATACTGTGCAGAGTCGAAGGATGAAGAAAAAGAATTGATGGAgagcagctcttcgctgcCTGAATTTGGTGTTTGGCTTATGAGCCAaacggaagaagc
tctaGGTGCTCTCTGGCGCCGAGCTTCAGTGGATATCACGTCCCTAGCGTCAGCTCGAGTTCAACTGCTGGTGGAAGAATCCTCTACGCAGTCCACAAAA
CAAGCCCAGACATTGGTAAATGCGTTTTTCGTTAGTGTGCTGGTGCGGTACTTCGCTGGCCCTTCAGTATCCTCGCTGGCAACCGCAGACcagcgtacat
gtagatctTCTGACAGAGATTGGAAGACCAAGTTTCAACGAGTGTTGGCTGCATGCTCGAAAGAATCAACGGGATTGAAGGCAGCACGATTCCAGCTATC
AGCTTTCCTGGAACAGGACGAGCTTACAGAAGCTGAAAAAACGTTctggctgaagctggtgtcgttcttcctcttttcaAACTAG