Description :
From Genome Similarity Track
Location :
Scaffold_20:93130- 96189
Sequence
3059 bases(100 bases per row)
TCACCCGAGGAAGAGACCTCGTGCTGATGGTACGGGCGGAGACGACCGACATAAAACGTAGGATGTGTACGCATCCTGCGAGACAACTAGATTGTGTACG
TATTGCCTTTGCGATGTAGTAGACGGAACGGGCCGATGTACTTGGGTATTCGTTTACTGCTACTCACATTAGCTACTACGTGCTTAGGTAGATTTACCGT
AGACAGTAGAACTAAGTCTCCAACATTAAAAAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCGTTCCGTTTCTGCCGGTCCACCACGTTAGAGATGGAG
TCTTGCTCGAAGCGGACCACTGCTTCTCGTTCCAGCAGGAAATCTTCTGCTGCATCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGCACCGCTAGGAGGG
CATCTTCCTTTTCAGCGAGGATGCTCTCATCCTCGCTGGTGTAGTCATTGGGGATGCTAAATATACCAGCATCGTCATCCTCATCTGGATCATTAATATT
GTCGTCACTATTACTGATATTATCAGCCTTGATGTCAATTTGATCGACATCGGCAACGTTCGCGTCATCGATTACCTCGACACGTGATGAGCAAGAGCCA
GAGCATTTTTTGCTCAAGCGAATCTCTCCCCCTTGAATTAGTGTCACACTCTAAATGGGTGGGTAGGCGTGGATGGCGTAAGCCATTCACAAAAGATGGT
GTATGCGTCGTCGATGCATGCACAGAGTTATTGATTGCAAACTCCACTATCGGCAAAAATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTCGAAGTA
TCTCTTCGAGGACGCGGTTGACGCGTTCTGTCTGACCATCGGTCTCAGGATGGTCAGAAGTAGACATAGTCAGACGTGTTTCGAGGGATTGGAACACGGA
TTGCTAAAACGTCGCCGTGAACCGAGGATCTCTATCAGAGACTAGTTCAAAGGGTAGACTGTAAAGTCGGAATACCGTGTCAATGAAGACGCGGGCACAA
CCATGTGCTGAGATTAGCTCATGAACTGCAGCAAGATGTACCATCTTGCTGAAACGGCCTACGAACACAAGAATACCATTATTCTTGTGAGCGTCTTCGA
GGAAACCGAAGACGAAGTCCATTGAAACGGACTGCCAGCACTCAGCCGGGATTAGTAGAGGCTGTAGTGGTGCACGGGATGAAGGACTGGGCTTCACCCG
TCGGCACACTTCACAAGCATGAATGCACTTGCGCACAAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTTACCGTGAGATAAGTCTTTTCACGCCCA
CGATTCCCACTAGTTGGTGCATCGTTGCACTCATACATGATGCGTAAGCGCAAATCATTATGAGTGGGGACGACGACACGAGGTGTGTTGCCGGCAACGA
CTGTATAAATACAGCAGCCCGTTGCGTGTTGTGTATCGATCCGCGGAAGATCGATACAAGGCCGGTAAATCTTTGAGAGATTTACGAGATGGAGTCACCA
GATGATCCATTAGTCGCAGAAGAGCCTTATTACCTGCGTAGGCCTTTTTATGTCGTCAAGCAATCTTGACGACGGAACACTAGTGACTAGTGTTGCACCA
GTGGTATCAATCCCACTTTTGGACTGCGCAGCCGACTCGAAATCGGGTCGACGCGACAGCGCGTCCGCGACGACATCAATTTGTCCGGATTTATACTCTA
CAGAGAAGTTGTACTCCGCAAAGAAGGACAGCGACCTCGCCATCCTTTGCAAGAGGTGTGGGCTGTTTACGGCCGTGGGTAATGACGCATGGTCCGTAAT
AGACTATAAACGGCCCATCTCCAAGGAGATAGACGCGAAACTTCGCTAGTACATACTTCATGGCAAGGAGTTCCTTGTCATGCACTGGATAATTAAGCTC
AGCTGCTTGCAGCTGACGCGATTAATAACAGACCACACGCTCTGCGCCGTCTGCATCGTACTGCATTTACGAGCAGCCGATTGAGAAATCGCTGGCGTCA
CGAACCACATGGAATGGTCTTTCTTGGTCTGCAAGCGCCAAGATGGGCGATTGCCTCAATCTCTGCTTGATAACTTTAAAGGAACGCTGACAATCAGCGT
TCCATGACCATTTCTCGTTTGTTTTCAAGAGACGATAGAGATGAACGGTCATCTTGGCGTAGCTGCGCGAGTACTTGCGTAAGTAAGCCGCTTGATCAAG
GAACTTTCTTAGTCCCTTAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCCTGATCTTTTCAGAATCAGGGCGTACGCCGTGTTTACTTACGATTCAC
CCAAGAAGTGGTATTTCGCTAGCAGCGAATATACACTTCATGAGGTTGGCATACAGCTTATGCTTGCGCATAAGTGTAAGAACATGATGAACGTGAGTTC
TATGAACCTCTACGTCTTTCTTTCCGCCCATAGCCCGGTTATGGACGAATACATCGTCGAATTAACTCGGTGCGAAGTCTCGCACCGTTCTCAACAGATT
TGTAACACATCTGTTGAAGGTGGCAGGGGCGTTACTAGGCCCTTGTGGCATTACTAGCCACTCCCAAGGCATACCACTCGGGATGATTACCACCGTGTAC
AGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGTCATCCATCAGATCCATGGACGAAAAGATGGTACTCTTTGACATACCATCAATGATTACGTACT
TCCTCGGCATCGATGTCTTCGCCGGTACCGTTGCAGCATTCAACTTGTTGAATGCGTGCACTATCCACCATCCTCCTGTGGCCTTGCGCACACAGAAGGT
CGGAGATCTGTGAGGGGAAGTTGAATCCCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCGATCACAAGTACTTCACAAGTACTTGTTCAC
GAGGCAGTGGCCACTGCTTCATGACACAGTACTTCGATCCCGGTTTGAGCTCGATCTCGTGTCAAGTGCCTTTATCCTTAGGCAACTCGCATGGCGCGGA
TTCAGGGAACACGTCCTTGAATTCGATTAAATCCTTATATAAAGGATTTGCCTGAAGCG