Description :
From Genome Similarity Track
Location :
Scaffold_398:9313- 14859
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_398-snap-gene-0.19GTPase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_398-abinit-gene-0.32Ser/thr protein kinase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_398-abinit-gene-0.31Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_398-snap-gene-0.2760S ribosomal protein L6

Sequence
5546 bases(100 bases per row)
TCGACGAAGATGCTGCGTCTCTCGTGCCTCGCGCGCGTAGTCGCGCCTGCACCGCTGCGCCTCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGCACAAGTTCTCCACGACCTCCAAGGGTCGCGACGACGATGACGACGACGATGAGCACGGTTATCACGAAGAAGACTTTGAC
GACATGGAGTTCAGTGACGACGACGAGGACTTTGACGACGACTTTGACGAGAACGACTTTGACGACATGACGTGGATGGAGCAGGGCAACGCGCAGTTTC
TCGACGCCGCCGACCGCAAGGTCGAGGAGCACGTNNNNNNNNNNNNNNNNNNNNGCAGAAAGTGCGCGTGCAGCGCGCCAAGCACTCGAAGCGCCGCTTC
GTCGACCGCATTCGCATTAAGNNNNNNNNNNNNNNNNNNNNGCCATGGCGGCAACGGCTGCGCGAGTTTTTTCAGTACGACGGTATTATTTTATGCATTT
TAGTGGTTGGATGAGAACTGACGTTGTGCTTTTATGTATGCTCGCGCGTATAGGTGAGTCGGCGATGCGCAAGCGTCCGAATGGTGGTCACGGCGGCGCC
GGTGGCAATGTCGTCATTGAAGCCGACGACCGCATCCAGAACCTCGCGAATGCGACGCACCATTTCAAGGGCGGCGCTGGTCTCAACGGAATGCGTACGT
TATGCATGATCTTTGCTTGCTTGTGTTTGTATTTGCACTCACTCTTTGCATTTGGCAAATGATTCTTCGTTATAGCGAATGACGCTGCTGGTCGACGAGG
CAAGCACTGCTTCGTCAAGGTTCCATGCGGAACGCTCGTCAAGCGCGTCAAGCGAGTAAGTAGAATAGTATCAACTAGCAGCCTCATTTGAGGAGGAAAA
AACATTGACTTTCGCCACGTTTTGCTGACTGTAGTTTGAACGCGAGTTGGAAAACGGCGAGTTTGAGATCGTGGACAAAATGGAGACCGTGTGCGATCTG
GACCAACCTGGCGCGACGTTCCTCGCCGCAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTCGGCAACCGCATTCTCGCGGGCAAGACCACGA
ACTTCGGTCGACTCCGCAAGCACATGCCTGACAACAAGGGCGTTGGTTCGCCCGGTACGTCGCAGTACTACGAGTTGGAACTGAAGACCATCGCCGATGT
TGGACTCGTCGGGTACCCGAACGCGGGCAAGTCCACTTTGCTGAGCACGCTGAGTCGCGCGACGCCCGAGATCGCGCCGTACCCGTTCACGACGCTGCAT
CCGTACGTGGGCATCGTCGAATTTCCCGACACGTATCGGCTCTCTGTGGCCGACATCCCTGGACTCATTGAAGGCGCACACCGCAACGTCGGCCTTGGCC
ACGATTTCCTGCGCCACATTGAACGAACCAAGGTATGTGTGCTTGATTGTGTTTGGCTTGAGCATGGAGTCAATCGTGTGCTGATGAAGCGAATCTGTGT
AAATGTGTGGTGACAGATTCTGATGTACGTGCTTGACACGGCGGGAACCGAAGGCCGNNNNNNNNNNNNNNNNNNNNNNNNNAGCGACTTTACGCACTTG
CAGCGTGAACTCGAGCTGTACGCGCCGGACATCACGACGCGCCCGTCGCTGATCATTGCCAACAAAATGGACGAACAAGGTAACGAAAGAATGCGCTCTT
GTTGTCCATGCAGCACAAAAGGAGACTAACAACATGGACGACTGGGGAATTCTTTTCTTGGTGTCTGTAGGAGCGGAGAAGAATCTGCACAAGTTGCGTC
AAGCGACGGACTTGGCAGTGCTCCCAGTGAGGTACGTTGCAACTAATTGGAGGCGCTGCTTGAGGCATGTTCGCCTTTTGTTTTTTTTGTTGCTGACAGA
TTGATTTTTGCTTTCGACCCTGTATTTCTCTCTTTCTTTTGTTATCTAGTGCACTGCACAAGGTAGACATCGATTCGATCGCGCGAACGTTGCGTTGGAT
GATGGAGAACTACGGCAAACTCACCAAGTCATGATAGAAACAAGCGACCACTTTTCGAGAGAAAAAAAGTTGGTTTTTTGCCGTTGTTGCTTCAAAATAT
ACCACATTCCATTTTCTACGGCCGCGCTTCGTAGTTGGGAGTCTATTATACATGGGAACAACTCCTCAGGAATGTCAGATGCTGCTCTCCAGTCGTGCAC
CCCACTTGGTTGCGTTCCGAGCATTAACTCCAAGAAACGAGAACGGAGTTGATCCCATGGATATTTTCGACTTTTCTGAGGTCATTTATAGCGAGCGCCA
GCCTCGAGGTATGTTGTGCGTATACAGTGCTGACTGACAAACAGGTAGAGCAGAGTCCCCAGACTTGTCACCTGCCTCTCAAACGCATACGCTCAGGCGA
AAATGCATCGGTACGAGACGATGGAGCTGCTCGGCAACGGCTCCTTTGGCGAGGTCGTCAAGGCACGGTCGCTCAAGACAAACGAGATCGTGGCGATCAA
GAAGATCAAGGCACTATTTCCGACCTGGGAAGAGTGTCTGCAGCTCCGCGAGCTGAAGTCGTTGCGNNNNNNNNNNNNNNNNNNNNNNTATTGCGCCACG
AGAACATCGTGCAGCTCAAAGAGGTGATCCGCGACAAGGAGGAGCTCTACTTCGTGTTCGAGTACATGCAGTCGTCTCTGTGCAAGGTCATGCAGCTCGC
CAGGCACCAGCAGCAGGGCGAGAGCGATATTGCGGGTGCAACTAGCAGTAGCAATGGCACTGGCGCATCGTCGTCGTCGCCTGCTTCATCTCCACCATGG
CTCTCGGAGGCGCAGATCCGCTCCATCATGTACCAGCTCTTCTGCGGCCTCGCGCACATGCACAAGCACGGTTTCTTCCACCGCGACATCAAACCGGAAA
ACCTGCTCTGCCACGAGGACACGCTCAAGCTCGCGGACCTCGGTCAGGCGCGTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGCTCCTGAGCTGCTGCTGCGCTTCCACTCGTACAACAGTCCGATTGATCTATGGGCGTGCGGATGCATCATGGCC
GAGCTGTTCCTGCAGGCGCCACTGTTCCCAGGCTCCTCTGAGGCCGATCAGCTCTGTCGTATCTGCAAGGTGCTCGGCACGCCCACAAAGGACACGTGGG
CCGACGGCATCACGATGGTCTCGCAGATGCAGTTCAAGTTCCCGAAATGCGCGTCTGTGCCCTGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCAGCACCGGTATTTTGACCAGCACCCCGTGACGCGGCCGATGCTGACG
CCGCCAGCTCTCTTGCAGGCGTCCATGGCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGACGGTGGCGCCGTCGAT
AGCGTATGGTGGCAGCAAGAAAGGCGGTGGTGATGACGGACCTGTCCACTCTGGATGGGCACGCTCCTCGACAGAGAGCCTCGGGTCGTCACGCAAGCAC
GGGTATGACGCTGCGCCATCGTCGTCGTACCTGCAAACCAAGCACAGCAACGTGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGCAAGTCTGCATTGCCGTCATCGGCATGGCGAGACATGGAAAAGAAGAGTGCGAAGGACACGTGCTACTCGGCGCGGAAGTGCAGCGTCGCGT
CGCCCGAGGACCTTGATGACAGTGTCACGCACAAAGACGACACGCGCCATCACTTTCCTCACTTGCAACAGTCTATGCGCACACAGAGCGAGGACCACTT
GCTTCAAGACCTGCTCGACGAGTTCATCGCGTAGTAGTGACACAACATACGTCCTACACAGTATCAATAGAAAAGAGGTGCTCCACCCATACGGAGTGAA
GCAAGAAACAACACCAACTTTAAAAGTTCAGCAGGTATTATCGTTTAGATTAAGCTCGCATCACGCTGGTTATGCAACACTTAGAACTTGAGCGCGTGGG
CGCGGTCGTTCTTGGTCAACGAGAACTTGGCGTTCAAGTACGCCTTGAGGAATGGCTCCGCGTCGATCTTCTTGATCAAGGCGGCGTCCACGGCCTTCTG
GTCCTTCTTGCGCTGGTCTGGGATGACTGGGGCCTGAAAGGAGTCATACAGAACGATGGGTTAATGCCTTGTGCGGTAGGGAGCTTTTGTCACGGCAGCG
ATCCCAAGCGCTGATAAGTGAAGCGACAATGTCTCCCAGAAGAAGACAAAGTCAAACTTCGTATACCTTCCCACAGAGACCACGTGTGGTGATCTCAATG
GTGCGGGTATGGTGTGTTCAGTGACAAAGGGGACCGGTTGTATGCCATCTAAAGCAATTAACAAAATAGAAATAACAACTTACAGCAGCAGACTGAGCGA
AGAATTGCTCCTCCTTGGTCTTCTTCGACGACACCTTCTCCTTGGCGAAGTACGCGTCGTTGATCTCTGGGAGCGACACACCCTCAAGGTCGACCTTGGT
CGACGTGGCGATCACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTCACGCGACGAAGTGGGACACCGTTCACCTTGTATGGACCTATGACAACA
AAGCAAATGTCAGTAAATACTGGACTTGATACAGATACCATGTCGTAGCACACGTCCGCCGCGCAGTGAAGCTGAAGCTCCATGTTCCTCAGCTCTCATA
ATCTTAACAATTCTTCGGCAGATAAGACCAACAACCAAACCAGCACTTCTCCCATAAATGGGAAAAGCGCCGACTAGGGCTCTTAACCATCTCCTTCCTC
TCCAGCAGTCAGCACTACAAGCGAGTGAACCCGCATACAGTGCATCGTCCCACCAGAAAAGAAAAAAACAGCCTCAAGCAGAGTCCTGTCTCGATTGCCT
CTCGACGTAAGTTTGCATCATTGGAACTCGACAAAGACGCTGCTGGCGGACCTGTGCTGCTACTGCTGTGTGTCGGCACGCTGACGTACCAGTGACAAGG
AGGAGACCCGATTCGAGCTGCTTCAAGAACACAACGCGCTTGCCACGGAAACGACCCGAAAGGAGGATCAACACCGAACCAGGCACGATCGACTTGCGGA
GCTTGGCGGTCTTGACCGAGTTGCGGGCGGTCTTGGCCGATGGCAATGGCTTTGGGATGTAGTCAGCTGGGTACCACTTCTTGGTGGACACCTTCTTGGC
AGCGACAACCTTCTTCTCACCACCCTTCTTGGCGAACTTGAAGCGGCCGTTCGTCTTGCTCAACGAGTTGCGGCTGATGGCATTGATGCCACGCGCAAGC
ACGATGTTCTGGCGCTTGGTGGAGGTCTTGGCGGCGGCTTTAGCTG