Description :
From Genome Similarity Track
Location :
scaffold_28:9310- 42626
Transcript NameFunction/comments
Pl_111790transient receptor potential Ca2 channel (TRP-CC) family protein
Pl_111791hypothetical protein PHYSODRAFT_378238
Pl_111792hypothetical protein PHYSODRAFT_566381
Pl_111793conserved hypothetical protein
Pl_111794conserved hypothetical protein
Pl_111795conserved hypothetical protein
Pl_111796hypothetical protein PHYSODRAFT_307593
Pl_111797hypothetical protein PHYSODRAFT_532805
Pl_111798conserved hypothetical protein
Pl_111799hypothetical protein PHYSODRAFT_532485
Pl_111800conserved hypothetical protein

Sequence
33316 bases(100 bases per row)
TCAACCAACGCTAGCGCGTGGAGGTTTCTTACGGCTTGATCCATTGAAAAGTCTTGAATTCTGCAACAATCGTCGAGCAGCTGCCTGTGCTACAGGGCTT
GATAGCAATGACACACCAGCACCACTGGGATGGCCATCATCACTGTCGCCTGAGCGCAAGTCATGCAATAGTTCTCCAAACCCACGTCCATAGCTGATGT
CGCTGGAGAAAATGTAGGCTCGGCCTTCTCGCTCGAACAACCTACCCAACGCAGAATCCACACCGCGGGGCCGCTTAGAAAAATAAATCGGCACAATCGT
TTTCCCTTTGTCTTCAGCAAATGCCAACTGATCGCTAACCAGCTCCGTCTTCACACTGCGTTCCGACAACACAACCAAAAACACTGAGCTCTGCAGAATG
GCATCCTTCGCCGCCAAAATACGCTCCTTAGTGCTGGATACATTCGTCATGGAATCAACCACAAATGGTAGCTGGTAGCGCCGAAGTTCGGTACACAAAC
GCGTCACAAAGTCGCGATGACAATCTCCATGAGATACAAAGATCGAGAACGTCGGGCCCCCTCCAAACGTATTCCTCCTTCCACTACCGCGAACAATTAC
AGCGTTTACAATTTCATCCATTCGCCGACGCCTCAATGTTGCAGCCCTGCTCAACGGTTGGTGATTGCTTACCATCATTTGAGGCAGGTCTCTATCGCCT
CCGAGCCGGTGCATTTCCACCTCGTCGCGCAAACCGTCAATAAGGCTTCGGAGACTGGCTTGGAATTTATCTTCGTCGATTTCAAATTCGACATGATCCA
CGGTTGATATGTCTGATATAGTAGATCCCTCCTCACTGGAATCTGCCGTCTTAAAGTGATGCGAAGTCACGGCCTGACCGAATGGTACAATCTGTCGCGT
GAAAACAAACACCTGCAACTCCTCAGACATTTTGACGGATTCGCATGAAATCGGCACCACAGGAACTTCGTGCTGTTTTGCAAACGCGAGTTCGTCCATG
CACAAGACACTCTGTGCGTACCCATCGCTAAGCATGCAAACAATTGCAGACGCATTCTTCATCACCTCCAGTGATGTTACTGAAGCACCACCACCGTCTC
TGCCTATCGCATCTTCTTCTTCGCTGCGAATATACACCGTCATAAAATTCTGTTCAATCCCGGCACGCACACGGTCAGCAAACGCGCGAAATATTGGATC
AAATGACAGCACAACGTCAACACAGCCACCGGCGACTTTGACTGCATATTGCAGCTCTGCAGAAGCGCAGCACTCGACGGCACGACGCCCTTCTCCATTC
AGCGCGTACAGATCAGCTTTACCCTCGACAAGCAAAGCTAGTGCAGTATCTTTATATCCGAGTCGTAAAGCGATGTGAAGAGGGGTCTCATCTATCGCAT
TCGGAACTAAGGCATTTACATCCGCTCCAAAACGGACAAAGAGCTCCACACAATCGCCTCGCAGAAGCCCACCATCGACAGCAAATGCCAGCGGGGTCAT
TCCATCATGGTCCAGCTGCAAAAAATCTGCATCCACGGCAAGGAGCTCCTCAACAGCTCCAGCATAATTATGACGGGCTGCCCAGTGTAGCGGCGTCCGT
CCATGACTATCCTTGGCATTAACATCAGCGCCATGCTTCACAAGCTCACTAATCACACGTTTTCTTCCCATGACGGCTGCCCAGTGTAATGGCGTGCGGC
TGTGAACTCCGCGCTGAAACTCGCCTAGTATGTCTGGGCTAATACCCCATGAGAGCAAGTGTTGCACCGCAGCAAGGTTACCAGCGGCAGCAGCCTCATG
TAGTGGAGTGAGTGCAACGTCAGCTCCCCATTCCTCGAGAACAGTAGCAAGTTCACGACGACCAGAGAGCTGTGCGCGTTGAAGTACCGTTGTGCTCGCA
GCATTTCCACCTCCTGGCACCAATAGTGTATTTGCTCGGTGTCGAATGAGGCATTCCATAACGTCCGCCGAATCCGCTAAGAATATTGGTGTGACACGCA
TAGAGCGCGAGAAAAAGCTTGATCGAGCGATGATGTCCAAGTTGGCACCAAACTTCACCAGGAGATCGATAACCTGAGTATGACCGTGTAATGCAGCCAC
ATGCAGGGGAGCCCCCAGTATATGTGTCACTTTCTTCACTCGTAGTTGACACAGCTCATATAGTAACTCCAGATTGAATGTTGCGCCTGAAATTTTGTCA
AGGAAGTTTGGATTCAGGCCAGCCTCAAGTAAAACCGACACGACACGTACGTCACCAGCACGACATGCTACATGCAGTGGATTGTGCGTTCGATGTGAAA
ACATCCAACAGAATAGAGCTGGTGTAGTGTACATACGATTAAGCAGCATGTCCAGCTGCACTTTAGATCCAAGCACATGCTCAGCACGCTCCACCAACTT
CTCCACTGCTGCACAATTCCCACTCGCCGCAGCATCATACAACGCGCCACGTAGTTGTCTTTCCACCGTGCGAACAGTACTCGGTGTCGTCGCCCACGGA
TGCAGCTCCTGATTCAGTGTCAAATACGAATCCACGTGATTTGATTGCAAAATCGGCGTATTAACCCCGCTCGGAGCTGAATTTTTATCCTCAGTACCAT
CCACACCACCAATGCCACCCCCTAAAGCTGTCGGCGCCACCGCCATCAATTCATCGTCCTCCAAACCAGCTCCAAGTTGCAATTGCTGATGGGCACGAAG
CTTGTCAAACTGCTGCGTGTGCAGTGCAATAGTGAGGATAGCGAACAGCGTGACATACGACACAGGATCTGTCCAAATAGCCCACACGCCCTGCTCCGTG
AGATCTCCGAATGCCCAATAGATACCGAGCATCAGCACCACAATCCACGAGAGCGACACTGTCTGCACTATCACAATAGCCTCAAAAATTGCCAGTGCCA
GTGTGCGCTCCAGCGTCTCCCCTGGGGCGTCAAAGGCCGAACGAGACAGCGAGAAGGAGCTGACAGTGCGTGTGCCCAGCAGTTGCTCGCTTGTGGTCGC
AGCAGTCGTTGACTCTTCGCCACTTGGAGCTTCAGCCACGTGCACGCGGTAGAGCGGCACGAAGGGCAACGCTGTCATCCCCAGCGACACGTTGAGCGCC
TGCAAACCGAGCCAAATGTCCAGCACGACGCCTTGTTTACTGGTGAAGAAGAGCAAGAACAAGGAGCCCAGAGACAGGAGCGAAGTGCCTGCCACACGCC
ACGTGTAGTACGAATTGGACCATTGCAGATACGCGTCCGAGCCGCGCCATCCGCCACTACTGGAAGCCGGAGGCGACGGAGACGTGACACTTGCAGCCAT
CTTCCTGATGTACTGGATGTTCCACCCACATATTGAGCCTTTGGAAAGGGATAGTTGATAGCGGAACGGATTCGAAGGGGTTGCAAGATTTGAATGTTGA
CCTTGTCAAAATGGATACGAGGTAGCTATCGGATTTGGAGAGAGCAGTCCCACCTCGACAGAACATGGTCGGCTCTGCGATACAGGAAGGACTTGCTTTT
GCACTTGGAAGGCGCTAATATCGAGTTTCCACTGCTGTTTGCATTTTACTGTCGACAAGCACTGGGGCTGCTCGACGCATCGCGAATTCTTGTGGCGACG
AAATTCTGGTCAAACAAGAAATGTCTCGGACGAAACCGCGATTGGCGGAATTTACAGCCAATCAAAGATTGCCGGCTCGTCTGCTTGATGCAGCCAGAAA
CTCCGCAATATGGGAGACCAGACTGTAGCGAACCTCAACCGACATTTTCCAGCATACAAAAGGTGGTCGGTCAACCAATCAACTGAACGTCCCAACGTCT
TTAGAAGGAAGAAAGCAGGACGAGGAAGAGGGCACACGTCACACACGTAGCGCGCTCACAGACACCACAGGCAACTTCAGACCACAGGACCCACAGCAGC
AGACGCATAGTTCACTCAGCTACTCGACGAGCTTTTCAAGTCTCCCAACAGCTCAGTAGAACAACAGGAAACAGGGTTTACAGGATATGGCCAAGCGCAT
CCGAGTGACCAAGCAGGAAGCCGCTGTGCCGGTGCCCACGGGCGTCCCAGCCGCAGCCAAAACGGTGACAGCAGTGCCAAATGGAAAGGCAGCTACCCCC
ACGAACGCCGAAGGGAAACATGTGATGCTGCCAGCGTTCCTGTCCAAGACGTACGAGATCTTCAGTATGCCCGAGTTCTCGCATGTCTGCGGTTGGAACG
CCAACGGAGACACCATCATTGTGTCGCAGCTCGAGGCCTTCGTGGCCATGGTGCTGCCACGCTTCTTCAAGCACCGCAACTTCCCTTCGTTCGTGCGTCA
ACTCAACCTCTATGGCTTCCACAAGACGGTCCTCGACTCGAAGCGACTCGAGTTCCAGCACCCATACTTTAAACGTGGACGACCTGACCTGCTGCACCAT
ATCAAACGCAAGGTGTCGAACAGCAACCACCATAATCAACAGCTTGTCGCGTCGTCTGTCCAGGTGGGTTGAGGTACGGACAAAGAGAGCGAGTTGGAGG
TTCTAAGTACTGTTGTTGTTGCTTTGATAGAACTCGCGGCTTGATGCCCACCGGGAGATCTCAGACACGCTGCTGCACGAGATGAAGGAGTTGCGTCAAC
GTAGTGACGCAATGGAAAAGCGATTGCGCGAAGTGGAAATTGACAACGCAGTACGGGCGAATTGGTACACTTTTTGCGATTTTTACAAAGTTGACAGTAT
TTCTGTGTTTTTGTGATGCTAGATTGTCAGGAGTGACAACCTCAAGTTGTGGAAGCACCTCGAGGCTGCGAAAGACAAGCAGTTAATCATGCAGGAGAAG
ATGAAGAAGATCATGTGGATCCTGTTCCAAATCTATCGTGGTAAACAACAAAATCTGCCCAAGCTCTCCAGCAATGATGCGACTGGGGCTGTAATCACCG
AAGAGTAAGTGTCGCAAGCAAACGATGGTTTCTGCAAACGGAGTATTCGATGTGTGACTAACCGTCTTTTGCTGCTGTGTGATATTTTCGATTCGTGCCT
ACTTCTCGTTGGCTTCGACTTTTTCTTTGATCTACTGGTAGCTACACCAACAACAGCATGCTTGGACCGAAGGAATTCCGTGATGTGCTGCGCTTCTTGG
CAATGGATGAGCCTGCGCTTTTGCCTGGGTCATCTGCTGATGTTCCAGCTGCAACACCAGGATCGCGAAAGCGTAAATTTGTGGAAGTGCCGTCAGATGT
CGGTGATGTGTTGACTGCCGAGGGTACACCTTACAAACTAGGTATGGTTTTTGTTATGTTCTTGATGCATTTCAACGTCGTCACTTACGCTTTACAATTT
TGTTGCTAGATGTAGAGCCATCTTCAGTCATCGAAGTTCCCAGTGCAGTGGAAGAATCCAACCCGCTTGCTATGACTGTGCAGTCCAACACACTCCCTGT
TGTGCACTCGGACAGGGGACAAAACAATGTCCTGAGCATCTTTTCACCAATCAAAGCAGTTAACAACAGTGTATCCAGCATGGACACAATGCTGGCTGGA
TTCCTGACGAATGGTGCGGACACGACACAAGACGTATCTGTGCCTGCCATCTCAGCACCGACCGTATCGACACCGGCTGTATCAGAACCGACAGTGTCGA
CACCAAGCATAAGCACACCGACCGCTAGCAACGGAGGACAGACATCGAGTGAAAGCGAAGCTGCTTTGGATGGTAATAGGACTGAATCGTCGGTGGATGC
TAACAACCAGCTAGCATTTTTGGACGAAGAGCTTCCTCTGCTGCCTGACTCCGACCACTACAACTTCACTGATGGTGAACAGGTACTGTGACGCATCCTG
TGGTCTTGTTTGGCTGAAGTTTTGTTTTGTTGTAAATAGTGATGTAATGGTGTGTCTATTGTTGGGCTGCGTATTAGCAGGCAGTAATGAAGAAACTCGA
AGATTTTGAGACGTCGTTGCTAGACGAATACGATGTCAGTTGCCTTGACACGCTCCTGCAGCAACTGAAAAACTCCAACGGGGAAAAATCAGCTGGAGTT
TCAGTGCCAGACCCTGAGGAGGTAGTGGTTGGACCAACTAATACATCCTCACACGACGCATAAAGCGGTGCTTTTGCAGACTACGGTGAATCCAGTGACT
ACCTCGAAGGTGTGAGAGCTGGTGACACCTGTGAAGAGTACCTCATCGAAAAGTTACATATCCAAGTACATGTCAAGCAAGTTGCCGCGCGCGTGTCTTC
ACTGGTAGAAGGTGTATCACACTATCTATTATCGGTTGATAGGCAAGCGATGAGTGTGACGGCTTGCGTCTCGTCCGGATGGAAACAGATCGAGTGTCAA
AGTCAAAAAGATCATGCGGAGCGATGGGAGCAGAGCAGTCTCCCGAGCGCGACGCGAACAAAGAGACGGAGATGAGTTCGTATGAACAAACAGCAAGAGT
TGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAACGATGACAAACACATACACGCGGCTGTTTTTATTTATGCAAGATGCAGACAACTAAA
AAACAAGAAACATGTTTAGTAAATATCCTTCGTGTTCCTTTGCAGCCCGCTCATTCATCTTCTAGGTGGTGCATTTAGACTCTCCAATTGACTACGCAGT
CGTTGGATCTCCTTATCCTTGCGACCAAGCTCCAGTTGCGCTGTAGCAAAAAGTGTCGAGATGTTGGTCTCCAGTTGTTTGTTGGCAGTGCCAAGTTGTC
GGTTCTGTTCTTGTAATTGCGCCAGTTCATCTCTCAGTCGTTTGTTCTCTTGCTCAACTTGTGTCTTGAGATCCAGCGCCTCCTTCTTCTCCAAAGCGCT
AGTGGATGTGTCCAAGTCTCCGTACAAGTCTTCTGTGCTCATGATGGCGCAAATCTGAAAGTGACCATACAAACTCCTAGTCATCAGCCGTTTCGGACTT
TAACGGAATTCAGTAGCAATGGACTCGAGGTGCATCAAGTTCTGGGAGGATGGCCAAGCGTTGGTGGCGATTGTGTCGGGCCCGGATGGCGCTGCAAAGA
TGAACACAACACAGGGAAAAATCTCCAAGGAGCTGCGCACAATGAGTCGTTTCTTGCAGCGCAACCAAGATCAACGCTTCAGTGACGCAGCGCAGCAGAA
GCTCGTGGACTGTGTGGGGCACTACGTGGGACTGGGCAAGCAAGGAGGAGCTATGCTACCAGTAGCTGAAGCCACGTTCCAGACGGTGAAGGATGGTCTG
GCAATGCCGTTCAATGTGGTCAGCACCAAGCAGAAGAAACGACTGCTCAAGTGGTACAACGAGCTCATTGCGATTGTTGGTGGAGACCCAGACGCCGCGA
TTGCTGGCGAAGTTGTCACTGAGCCAAGTATCGAGTGGAGTGTCATGGATATCGACGAAGACGGATTCCTATCGCTCATGCAAGTGGACACAGGAGACAC
GAATGAGAGTTTTCAGGTGAAGAAGAAGAGTGCAGAATATAAACGCATCAAGAAAGCACTTGAGAACAGTGAAGTGACTGTTCTTACCAGTGGTGACGAT
ATCGAGGAGATCCGAGTTGAAAGCGAGTAGAAATGCTTCCAATCTGCATGTTAGATCATAATTAAGGGTGCCTGAAGATGACCCTGTGCCTACTGCTCAG
TTAGAAGGGACTGGCAGCACCCTTCTTGTCACGGCTTTCAGTCCACGCCTTGGCGATCGTGCGCTTCATCTCGTCATCGCCTTCGTCGTACATGTTCTAT
AGAAGCAAAAACAAATGTTAGTCCACAGCATTGCAGTTTAATCTATCAGTATAACAGTTAAACGCACCTTCATCATGTCCATGATGCCAGCAGTTGGGTC
GCTCGTGTCGGGTTTGCTGGTCTTAAGCGGATTCTTAGCCGTAAGGTTCATCCACGTGTTGTTCACGTCCGCCTTGTGAAGTGAAATTGTAACTCGGTTC
TTCTTCACGCGGAACGAGCTCTTCGTTGGGTCGATCTCCTTCTCCAAGTGCTGTTTAACCAATCTGCACACTACTACGTCAGCCATATCCCTCTAAACCA
CATCAGCTCACCACATACCTGTAGTTCTTGTTATCCAGACCGATAATCTACCAATAACAAGTCAGCTATCTACAACAAAAGGTCAATAACCAAGCCAACC
CACCTTCAGATCGAACGACGCCTTGGTGAAGTGGCACGTCACATTCTCCTTGGGCAAGTTGCCGACTCCATCAATACCCGACATGATGTAGACCGCCACT
TTCGCTTTGCCATAGCCATCGTCCTCCCAGCCGAAGCGACTGATCTCCGTGAACATCGTGACGTCGGTGACAGGTCGGGTAGTTGTCACCTTGGGCGTCT
CCACCTCCTTCGGCTCTTCTTGCCGGGGCTCAGCGGCCTCCAGCGCCTTCTGCTTGCGCTGCAACAGCTGCTCCAGGTCACGGCGATTGCCAGGTGTCTT
AATCTGCGTCAACAGCGTCTGGAGCTCGGCGACTTCTGCTGCGAGGGTCTCCGCGCTGCCTGCCATTGTGTAGCTTGTGGCTTTGCGATCCTATCAAAAA
ATGGTCTGACCAAAGAGTTTTTTCGAGAACAATCTTTTATTTTGTGTCGCAGAATTGAGTCAGACTAATTTTAGTATTTGCAATTAGAGCGCAATAGTTC
TCTATAAGCGGCGCGAAGGATGGAGGAAAGAGCTCTGGCCTCGGTCGCTGCCGGGGTTTCAGGGGACGTGTCGCTGCTATCTCCTTCTCCTATGGATGTG
GAAGATCCTGCACCTGTGTCTGATCTTGCGGAGCGCTTCGCTGCGTTCCCTACAGGCCCCGTAGCGTCCTCCCAAGCGACAGTTCAGTCGACGACAGATA
CAACACCCACCAGGTCTCCTACGCCTCTCACAGCGACGTCAATAACGCAACCTAGACAGGAGGAACCGACCAACCAGCCTACGACTCCAGAAACAGCTTC
CTCTGAGAGATCTGCAAGCGATGGAGTGTCGACCCCCACACAGAGCGAGAAAGGCGTCATATTGACACAAATTAACGGCGAGAAGGACCAAAATGGAGTA
CAATCAGATGCAAACAGCAGTGCTCAAATTGGAGGTGAGCAGGAAGCACAGGTCTGCCATGGAGCAGAATTGACGACAGGGAACGGGACCGCTGCTAGTA
GTGAGCAAAATGGAATGCAGACGGATCAAAAGAAGAACAAAATGTGGTTCGACGTGCTGCCAATAGTGCTACAGAATTTTAGGATGCGCAACCGAGAGCA
GATCCGACGTACGTGTAGATGTAGGTTGTGGCTGTTTAAATAAGTATTGACTGAGTGATGTTATGACTGCAGAGTTGATGATGACACGGTGTGTACAATG
TGAGCGAGGAAAAAGTGACAGCAAGGCAGAAGTCAAGTGTAATCAAGAAGACTCCACGGTGTGTACAATGTGAGCGAAGAAAAAGTGACAGCAATGCAGA
AGTCAAGTGTAATCAAGAAGACTGCATTTTGATGGGCAGCCCGCTGTGTTTGTCTTGCTGGAAATCAACACATTCGTCGGAAGACACACAAAGGCATCGT
CGGCTTGCTGCTTCAAGTGAGTTTTGCTAGACAAAAGGAAACCGTGCAGCTACTAATGAGTTATGTTGTCTTGTGTGATTAAGTTTGTCAGCAATGCCAA
CTAGATCCGGTCGCTTATTGGTGTGCGGAGTGTGGCCTGAAATTCTGCATAAAGTGCTTTGATCAGATTCACAGTGTGCCCAGGGCTAAAAGTCATCGCA
AGCTTGCTACAGAAGGTTCGTCGATTATTGCGATGTTCCTTATCAACTACCGATCATTAAACTTACACATTCTTGTTTGTTACTAGATGCACCGGGAACC
TGCATAGCAAAGTCTAACTGGTCTACGAATTTCCAGAAAGTGATCATCCAAATGATCGCAGCGCGGAAACGTCCGCTTCCAGCGTCAAATGACAGTTCCG
GCGTCGGCGCCAGTGGAAAACGAAAACGCGATGTTGAAGTGATTGTCATTGATGACGAGGAAGATGAACACGAAACGACGATAAATAACGTACAAGCTGG
CTTATCGTCTTCCAATGGAACGTCTGAGCAACCCGTTGCTAATGGAACTCAACAAAACGGCAGCATTGCTTCTACCAGAACAAATCCTCAAGTCCCGGGT
GGTCAGAACTCAATCCTAGAGCCCATACCATTCAACCAGGGTGTTACTAGTACGGTCTCAGCACCGTTAGCATCACCAGTGCGACTCGAAGCAGTACCGA
CCAGCTCAGTGTACAACGCATCTTCAAATTCAAACCGAGCCAATATCAATGCAAGCGTCGGGATGTTACCGTGGAATAATAGTGCGCCTCAGTTCGGGGT
GCAATCGTCAATGGGAAATGGAAGTAATAGCATGATATTCGCGAGCAATGGGATGATGGAGGTAGCACCAACCACTATGTCGAACTCTGTTGACACGACG
GGCAATGTGTGGTCGACAACGTCTGTCATCAGTACAGAATTGGCTAGCACATCCAATCCCAATAATCTCTTACCGCTAGGAGGTGCCGTTTTTGCGGAGA
ATGCTCTGGTTGACTCGTTGGTGGACCGCTATCATGAAGTGAACCAAAACGTGACAGTACTGGAATTGAAAAGTGAGCAGTTGACCAAGCAGATAGCAGT
TGCGACGTGCCAAGGACCGTATGCCGCAGGGCCAATCATGGCCATACTGAGCAAGTTGCAGTCGGTATTAGATGCAGCAAGAAAGCGACGTGACAAGCTC
CTTATCGCGATGATTATTCAGTCCAACGATATCATGGCTTGTGTACGCCTTCTACGCCTGACTGAACTCGGCGATGTACCACAGGTACCCATGATAAGCC
ATCGCAAGTGTTTACAGATATCAAACGAGATCAATCAACACAAGAAGAAACTTATCGAGCTAAATCAGACTCTGAGTGAGACACTTAACCAGTCCCACGC
AGTAAGCTCCAGTTGGGAGACTACGCTCATTCGAACCACTAGCGCAAACATCCAGATGCACGAAAAGAGCATCAAGAAACTCAAGAAAGACCGCGAGGTG
GAGATCGTGCGCATTGTGCAGTTCAGTCGCAATATCCGCGAAGCTCTAAAACAGACATTTCAACAAAATCTGGAGGTACAACGTCAACAACGACAACATC
AACAACAGCAACAACAATTTCAGCAGAATTGATAGTTTTGTAGGCAGAAGCATCGCCATCGAGTGGACTGAGTGACGGCATTATGGAGAAGATCCAGCTC
AGAACGTCAGAATGTAGGCAAACTGATTATTTAACGAGGCAGAACATGCAGAAAATGAGCTGTCAACCATGCCGATACACGAGGAAGCCAATTTGACCTA
GGAAGAAATACAGCATCCTGCTCAGGATCAAGCACGCAAAATGTAAGTGACAATTTACAAATTCAAGCATGATCAACACAACTAACTTTTTGACTTCATG
CGAGACAAAGGATCCGAACGATTTGCCCACGATGACATGCCACGCGCCTTCTTGGGTCTCCTCGATTTCGTGCTTGATCTGCTGTGCAACCTCTGTGAAG
TGGTTCTTTTCGCCCTTGTAAAGTGCTTTGAGCGCGTTTGTGGCGCTCGTGAGGATAAGCTCTTCCAATTCCTTGGATGTGTCCTGGTATATGATACGCA
GACCACCTACAGCAACGTCATCTTTCTTTTGAGCCTTGGACATGCTGTATCTGCTGGGGATCTTTAAGTTGGATGTGGCGTCGCGTCGGTTATTCGCTCC
CAGCTAAATCAAGCGCGTACATGTTTTGGTGCAAGAACAGCGACAACTAGCAACAGCAACCACGATGTCAGGGACGAAGGACATCTACGAACACTTGCTG
GAGCAAACTGTGCACAATGTTTTGTTTCATGAGGTCACCGAGGAACTTACTGAGCATTCCACTACTGTAACAGTCTCTAGCTACAGTGTACACGATATTG
TCAACAAGACAGCCTCAATGGACATTTGTGAAGACTTGCTCGTTCACATGCTGACTCATTTCGATAAGGACCCTGCTGAAGACGACGAAATCAATAATGC
TGATGAAACTCGCCGTGGTTCGTGGCTGCTCGATTGCCCAAATTGGTCCATCGATCGTCTTAGACGCGAAAAAGCGGCTATCAAGAGATATATCAATGCG
CAACGACAGGAGCATATCAACGACGGCCAGAAAACGATGAAATTGAATGGTAACGTCTTGCTAATCCATGAAGTGTATGCTCTTCTCAAGCTTTTCCTGC
TTGAACGGGACCCTGCTTATCGTCAGTGTTTGGAGCAGTCCAATAATTGTACCACCTCGTTCTTGACGTCACTGCATTTGCAACTTACTCTGTACGCGAC
GTACTTCGAACGGGCCCATGGAAGACAGGTACGATTGCCAACACACCTCCATTCAGAGTGTATTGACCTTACGTCACTACAGATCTCAGAGAAAGCCGAT
GTGAAGCCAATTGAGACGCTCTACGACTTTTTCCTCACTCACCACCGAAGGTCGACGCAGCAGCAAACCGAGTAAGAACGAAGTAAATGAAGCTCTTTTG
TAGGCGCAGCTTGTGTTCCAAACATCGTTCACTCTACACGAACGAGCTGTGGGTAGGGATTATGTCATCCTTCTTTGAGTCCATGCACGGCACTGAAAGC
CACGCGTAGTAGAACGCAGCACCTCCCAACATGTGCATCAATCCTTTAGCGAACCCCAATGCCGTGTGGTTCTTATCATCTTCAAAAAAGATAGCGACGA
GACCCACAATCGTCGCTGCAATGAGACAGCCCACTGCATACACGGCGTTCTGCTTGTTAAGTGGAGAGATGTTACCACTCGGGGTGAACAGCCGTCGGTA
CGCGACGCCGAGCAAGTAAAAACCCACGAGCATTCCCTCGTAGAGTGTCGAGTCCCATCCGTCCTTGGTCTTGAAGAGCCATGCGCCCGCGAACGCCACG
TAGCGCAGTACAATATTGTGGTTTTCGTCCTTGTAGCCCATGAGGTGAACACAGAGCAGCAGGAAATAGGAGATAGACAACACATCCGAGATGAAATGCC
ACTCGACTTCTTTGAGGAACAATTGCGTGTCGAAAGCCTCAGCGGCGTTGAAACTAAACGCCACGAGGAGCTGCAGCACGCCCACGAACAGCTCGAAGTG
TCGGCGATTGCGCTTCATCACGTCCAGCGCCGGCAGCATCGCGGCATCCGTCAGCGCGAGGAACACGAAGCGCCCGAATTCCAGCAACATGTTGACAATT
GCGATCGTGCTGCACAAAAGTATCCCCCGAAATTCAGCCAATCAGAACGCAATGAAGCATGTGCACCTGAAAAAAGCGATAACGGATCCCAATCGAATTT
GAAAAAAGACCTCGTTGAATGTGAATCCGGTAGTCGACGAGCTCAGTGCGCAATCTGCGAGATAAGACTCAGAGGACTCGGAGGATGAAGTCGACGCCTG
TTCTGCTGGATGGCAAAGCCACAAGCGACGCGATACGAACGCAGCAGTTGCAGCCACAATGCTCCGTCTTTTTGGAGCGGTATGGTCGTCCTGTGGGGCT
GGCAGTGGTGGTCGTAGGCTCCCGCAAAGACTCGGCCACATATGTGCGCATGAAGCAGAAAGCTTGTTCGGCTACAGGTATCGAGTCGTGGAAGATCCAG
ATTTTATTGAGCGAAGATGGCAAGGACAAGACCGAGGAGAAGGTGACTAGTGAGCTGTTGACGACGATCGAGCAGCTCAATGCACGTCAAAATGTGGACG
GCATCATCGTGCAGCTTCCACTCCCGTCATTCTGTGATGAAGACGCTATTCTCGCCACTATTGACCCCAAGAAAGATGTGGATGGCCTGCACCCAGAGAA
CCATGCCAAGCTCTTCCAGTTTGCAACCAAGAAAGCTTCTTCTCAGCGAGAAGAAACGCCATTTGCACTGCCTTGTACACCTGCTGGTTGTCTGGGGCTG
TTGGACCATTATGACATTCCATTGGAAGGAAAGCACGTGGTAGTGCTCGGTCGCAGCCAAATTGTCGGGCTGCCTGTGTCGCTGTTGTGCCTGCATCGCA
ATGCTACAGTCACCATATGCCATTCGCGTACCCAAGACCTCAAGGCGCGTGTGCTTGAGGCCGATATCGTCATTGCGGCTATTGGACGACCGCGCTTCGT
GCAAGGAGACTGGATCAAACCCGGCGCCACGGTGATTGATGTCGGGATTAATCCTGTCGAGGACACGTCCAAGAAGAGTGGATACCGTCTTGTGGGTGAT
GTGGATTTCGATGCTGCACTGAAGGTCGTGCATGCTATCACTCCAGTGCCAGGCGGTATTGGCCCCATGACTGTTGCTACACTACTCAAGAACACCATTC
AGTGTGCAAAGCGACGTATGCAACTACAATGAGCAAAACTTGATTTGAATGAGTCGACGACAATTCTTCACCGTTGTTTGGATAATCACCCCTGGCCCAA
CAAGCGAACTACAGTTTGCCCGGCTTTGGCTGCTTCTCCTAGTTGGTAAGGCAACACTAAGTACAACGTTCCCTGACCCGACTTCTGTGTTGGTTATCAT
CGTTCAATTCACCGATAAGCTAAAAGTTTATGTCATTGTCATCGTCGTGTCCAAATAGCAATTCGTCTTCATCCTCGGACGAGAACTGCCCACTCTCTTC
CACAAGCTGCACGTCTTGGTGCAGTTCTTCCCAGTAGCCTCCATGCGCTTGATCAGCATCGATTGTACTCTTAGTATCGCGATCGGTAGCAGCGACATGA
TACGAAGCTTGTTTCTGATGAAGTTCGTGCACAGCTTCTTCCAGTCTTTGCAGCGCTGTCTTCTCGCTAGCTGGACGAATTAACGGCTTTTGTTGTTGAT
CTTTTGCTTCAATGGAGGGTGCAGCTCCATGTCGACGTTGTGCTTGGACCAATAATCGCATGCAGTCAAGCTGGCCATAAGCTGCTGCGATCTGTGCAGG
TGTCTCCCAATCGCTATTGGTGAGTGTTGGATCTGCTCCCAACGCTAGCAAGCTCTGCGCTACCGCGGCTCGACCCAAAAATGCCGCCCAATGTAGAGGA
GTATCACCTCTTTCATCAGCCACATTCACGCTTGCTCCATGTTGAATCAATCGAGAAATAATCGGAAGTGCAGCGGGTGATTCTACTGCGTAGTGCAATG
GAGATCGATGCAGGTCATCGAAACAATTCACGTTTGAACCTCCTCCAGGGGTAAGCAAAAAGGTAGTCATAGCTATATCGTGAGATAGAACCGCAAGGTG
TAGCGCTGTTCTACCTTGTGAGTCGCCCTGGGCTTGAAGCATACGGTTCCATTCATGGTTTGCTTGAGTAGTAATCACTAATTGTTTTGCGCACTCCACA
AACCCCTTTTCAGCTAGACAATGAAGCGGATATCGCCCTTCACTATCTGGTGTATGAAGTACGAGAGTAGGTGGTAGCAACTTCGCGACAGTATCACCTA
GCATAGTGTTCTTCTCAATCGAGTCTTTCATCATGAGCTGCTGTAAGAAACCGCAGATCTCCACTTGATCTTCTTCGCAAGCTCGGTGCAGCACGTTTTG
ACCTCTGTGGTTTGTCAACTGAATATCAGCTCCATGTTCCAACAGCTTCTGTATGAATTCAAGGTGACCAAGGGATGCATATAGCATCAATGGCGCATCG
CCGTTGCAGTCCACGCCATCTACGTTTAGGTTAGCAATAAGTAAAAACTCAAGCATTTCAACCCGGGATCGAAAATTCTCCTTGGAAAACGACAACATAT
GCAGAGCATTGCGTTGTGTTTTCGACTCGAGGATTCCCAAATCAGCACCACGCTGCAGGAGAAATATTGCGTCGTCCACTGAGGCATTTTCAACAGCAGA
GAATATTGTCACTTCCTTCTTCGCTCGTTGAGACGGTGAAGATGACGCAGATCTTCCATTTGGAGATGAGGACACCGACTTCGTGACTGACGATGTTGGA
GACACTATGAGCTCTTCGGAACTTGTATTAATCTTTAAGAGTTGTTGACGTCGAAGTTGAGCGCGATGTTGTTCCATTTGCCGAAGCAGTTTGACGGAGA
GAGGTAGTTCCAATTCGCCAACATCGTGGTAGCGAAGTTCGGGCCTCGGGTTATCATTATCTTCTAAGCAAATTGATGATAGTAGAATAGGAAACGCATC
AGTCGTAATCTCGTGCAGTACTTGCTCAATTTCCGAGGACAAATATTCATCACTTGGCTCAATCAATTGCAAAAGTTTTCGCGTCATTTGTGAGTCAAAG
CGAAGGCGCAGTAGCGACTTTGTCCGATTGGTATCTGGTGCCCAACTAGCAGACCTGGTTGATTTAGATACGTCCCAATCTAACCAGGCTCGCGCTTTTA
CGAAGTAGAAATGAAAGTACTCATTGCTTACGCTCTTGTCAGCTTCCGCTTGCTCACCCGGTGTAACAGCAAATAGCCGTTGAAAGTAAAAGTGAATCTT
TTGCCGTGTCTGGTAATCTCGAAAACACTTTTGCAGTACAGTTACTGCTTCATGACAAAACAAAATTTGATTCACACTGCGCGATAGAATATGCGGTAGC
TGTCGGTCGCTCCAGTCTTTAACTGTCAATTCCACAGTAGCATGAATCAACCCTTGCTTGGATAATTCTATCGGTTCTTGAACAATTCCAAACTGATCCA
CTGGTACTTCTGCTGATTCTTGGAGGTCACATGTAGTTTCTTCATTCTGAGGGTGGTCTAGAGGTTCTTCATCCAGCCTGTTAGTTGGTGTTTCTTGCTC
GGCTACAATTCCCTTTTGAATCGCTTCTCGATGTGAAATACCCTTAGTAGCAATCAAAGCCCTTCGAGAAGCTAAGGCCCGTTGAATTCGCTTTGCCGCC
AGTTCACGCTTTGCAGTAAGTAGTCTCCGTTCGAGAACTTTTGTCTCCTCAATTAAACGAAGCTCTTCACTTTTCACCGCTGCACGCTTGACTTGTCGTA
CGCCAATATTCCATCGCCGCCAACACACTTGTACTTTAGTTGCAAGGACTGATATCATAAGCCGATATTGGCGACTTTCCTCGGCATGTTTTTCTTCCTG
CGCTTGTAAATAGTAGGTCCGATACAGTTTTCCTCGCCATATAGCCTCAATTTTGGTTGCAGCACTCGACTCTCGTCGATTCTGAAGGTATCTCATGACC
GCGCGCGCGATGCATCGACCATACGATCGATGCGTAATAGCATCTAGTCTTTCCTGGCGTTCTTTTTCGTCATGTCCAAGTGGAATTGTGTCGGGTTTTC
GCTCCGTCTTCAAGTTATTTCGTCGCTTTTGTGGTTTTAAATCGTTGCTATTAGTCTGTTGTTCATGACGAAGATGCCGCCACCTCCTCCAGTGTTTTTG
TATCTTCAGAGCGCTGAAATTCTGCTTATGGCGAATACGCTCCTGGGATAACTTTCGTCGTTGGTGTGACATTCCCCAGTTCTGTTGGATCTTCATCGAA
CTTTCGTCCTGCTCCTGACGAATTCGTTCTCGTTCAATTTCTTCCTGCTGTTCATGATGCCACTTAAGGTACATCATTTGGATTTTGAGTGCAGCCATGT
GTTGTTCATGTTGAATACGCGTTCTCTCCATTTTTCGTCGATGCTGTCGAATTCCCCAGTTCCGTTGAATTGTCAACGAGCTCGTGTTCCGAGTCTGCTT
AACACGTACCATCTCTCGCTGCTTTTCACGATACTTTAGCTCCTTACGCCAAAATGTTTGAATTTTTAACGCATTCACCCCGTACTCCTGCTGCAATTGT
TCATCTTCGTTTTGAGACTTCGGCTCCGTTTCTTGCCTTTGAAACTCCTCCTTCTTCAGCACACGAAGGGTAGCTTGATTCGACCGCCACAGTTTTTGAA
TTTTATATGCACACGCATACTGTTGTTGGAGTTGGTATCTCTTAACCTCGAGCTTCCCATTTTTTTGCCACAGCTGTTGGATTATCAATGCGGCTGCAGT
ACTGCGCTGTTCCAACTGCGCTTGTCTTTCATGTTCAAGGTGTGCCAGGTGCCACCTCTTCCATGCTCGTTGAAGCAATGTTGCACTGATACACTGATCT
TCTTCTAGGCGTTTTTTAGATTGTACAGCTTTCTCGTGTCGATGCCATCGACGCCACTTCCTCTGGATTCGCTGAGCTCCTAGGCAACGCTTACGTTCAT
CTTGCTGCTTGTTGCGTCGGAACAACTTCCCCGCCCAATTTTGTTGAATTCGTAGTGCAACCGAACGCTCTTCATGTTCATGGCGTTCTTGTTCTGCTTT
TTCACACGATCGTTTGCACCATCGTCTCCAAGCTCGTTGGATTCGTTTGACGGCATCAATCTCAAATTTTTCACTTTGTTTCTGCTTCCACCACTTGTAG
CAAGCACGTTGTATCCTTGTCGTGCTGATTTGCAATGTACGACCCTTCTGTGCCTTATCTTGCTCAACTCGCTGAATTTGAAGTCGTTCTCTTCTTGCTA
GTTGCGATCGGTGCCATCTTTTCCACTTCCTTTGTATCACTTGAGCACATGCATTACGCATAATTCGATCTCGTGTAGCCGTCACTCGCTTTTTCTGCTG
CCATTTTCTCCACCACCTTTGTATTCGGTGAGTACTTAAGAAAACTAGCCGATGAACATGCCTTCGCTCTTTTTGTTCTCGATCACATGCAACCCATTGT
CTCCATGCGCATTGGATTTTACGGGCATTTGTCTGAATTCGTATTGCTTCCAGACGTGTATCAAAGGCTAATTGTTGTAGACACCGTCGGTCATGTTCAC
TTTTGATCCAACGTCTCCATACTCCCTGGATCTTACGCACGTAGGCTTGAATACGAATCACGTTTAGTTGCGCATCAAATGCTAGTTGCCGCACATGCCT
TCGTACTTGTTCATGCTGAGCCCATCGCCTCCATGCTCTTTGGATTTTGCGAACGTTGGCCCGAACACGAATAGCTAGAAGACTCTCATCAAACACTAAT
TGTTGATGGTACCTTCGATTTTGTTCGTGTTGGACCCAGCGCCTCCAAACTCCCTGAATTCTGCGTACGTTTGCCCGTACTCGTATCAATTCGAGGTGTG
CATCAAACATTCGCTGTTGCTGAATTCTCCTCTCTTGCTCGTGGTGAACCCAACCCCGCCACACTCGTTGAATCTTACGAGTGCTGGCACGATTTTTTAT
AATTTTCAGGTGTTTGTCAAATGCAAGCTGTTGCTGATGCCTCCGTTCACGCTCGCTTAGGACCCACTTTTTCCATACTCCTTGGATCTTGCGTACATTA
GCTCGCAGTCGAATTGCATTCACATGCTCTTCGAAAGCTAATTGCTGTGCTCGTCTTCGTTCATGCTCGTGTTTGGTCCAATGTTGCCACGCTCCTTGAA
TTCTGCGCACGAAAGCCCGAACGCGAATCGATTCTATGCGAGCATCGAAGGCAAGTTGCTGCTCTCGTTTCTTTTGTTGTATTTGAATCTGCTTTCTCCA
CCATATTTGAATTCTTCGAGCTAGTGCTTGACGTCTTTTTACTTCTCGTAGTTGACTAAACGCCAACTCTTCTGCGCGTTTAATTCTCTGTTGATGGATC
CACTGGCGCGAAGCTTGTTGAATTTTTCTAGCGCAATTCACGCTTCTCAAGTACTTTACCTTTGCACATTTGTGGATATGCGCTCTGTAGAACTGCGCCA
CACTACTCAGACCCTCCGCAATGCCTTCGTTAGTTTCCCGTTCGGTCAGAAGTTTGATGTCGATAATAATCTGCACTAGCTGTGTTCGAGTGCACGTAGC
AATAACCTTCTCCCGTGCTGACCTTTGATGGTGCTGTATCCGTATCGCCTCCACTGTTTTGTGATTACGATGTTGGCTGATGCGTTGGCGCATGAAACTT
GATGCCTTTATCGAAGCAACTTCACGCATCTTCGCATCGATCTCTCTACGCTGTTTCTGTCGTTCCTCTATCATCTCACGTGCTGCCGAGGTGCTGATTG
CAGCATTTTCCTTTTTGATTTTTGAAAGCTGCATCTGACCAAAAACCCAGGAAGCTATCTGTTGCATGCTGGCTTTGAGTTTGTTGTGTTCTAAAGTCTC
TGCTGCTCGCTGAGCTTCCTGTGCCTTCTCCACCGCTAACTGATTCTTAGCTTTTACCAGTGCCTCAGATCGAGCCTCCAACTCGGACAACCGCTGTTTG
AGATCAGCTTCTGCTAATGACGCTGTCCGACGATGCTCTCGCTGTTCTTCACTAGACATGAGCTCAGTCTCTGTTTTCTCTGTTAGAAGTCGTGCTTGCT
CCAACAAAAGCCTTCGTCGTTCTCTATCTGCCCTTCTACACAGCGTCCGAGTATCGATGAAAGCCTTAATTTTCAGTTGAGCAGCACGTTCCTGGGAATG
CACTTCCCTCTGTTGGTGTACTTGGACGATTTCGCGGTGTCGACCAACGGTTTGCAATGCTTCTTGTGCCATCCGACCAATTTTCCGTTCCAATACTCGC
ACTTGAGTTCGTGTCTTACTGATATGCTTCTGGGTCTCAACTTCTAGTTTTTCCTTTGTAACCAGCTCTTGTTGGAGCTTGATCTCATACTGTTTCTTCT
CTGTTTCAACTCTACGCAGCTTCCTGTGAAAATGGCACACTCTGAAAAACATTTGGATTTTCAGCGCTGCGAGGCGTTTTCGTCGCACCTCAACTGCTTG
TTGTTGTTGGTGTACCACACGCTCATGATGCGTCAGAAGTTGCAATCTTTCCTCCTCTGCAACCTTCCATCTGTGGTCAAGATCTACAAGCCGCGCGTTC
ATATCTTCAATTAGTTCTCGTCTGTGCTTTGAGTTGATCTTCATTGTCCTCTCCACGTCTCTCTTTGCCTTAGTCCATTTTAGCTGTTCCTTAAACAAAA
TGCTCTTCGCCATCTCCTCAGCTGTCTTCAGCCTGCGACGAAGTAGAATTTCTTTCAAAAACGTTTGTATATCCCTCCGAGCTCTTGATCGCTGTTCTCG
TTCCCGAACAAGTTTTTCCTGACGCTGTTTATTCTTCTTGATACGAAAGCGCTGAAATCTCCACCACCTCACCAACTTGTCCTTTGCATATTCACGGTAG
CTCCGTCGTCGTGATATCCCCACGAAAAAAATTGTGCGGTGGAATGCCATATGAACAACGCGAAAAGTAGCTTTCCGTTTGGCAACGTTCTTGTTATGGC
AGTATAAGCTCCAGTTACGTTGTATTCGTGATGCCGCGAGGAATCGAAGACGGTTAGCTTCTTCTATCCGAGCTTGCAATTGTCGACAATGATGATAAAG
AACGAAATGTCGGATCTTCCTTCTTGCGACTAACCTACGAACGACCAACTTCGCACGTTTTTGATCTACGATCGCTACTTTCCAAGATGTAAAGTTCCGG
CGCAGCATTTTCAGCTCACGCTCCAAGTATTTAGGGGCATTGTCGTTAGCACTCATCGCTTCAGGTGATGCGTAGCCCATCAATGATGAAAATGGCTGTG
CTACCGACTGGATATGGTCTTCCACCTCTCGCTGGGACACCCAGTGGCTCATGTCAAATGCTGCCACTTGGATGTCTCGACAGAGTGTAAAAATTCTGTT
AAACTCGGATAGTTGACAATCATCGTCTTTTTGGTAACTTGTCGCTTCTGAAATGCTGCTACGGGATGAGAGAGGCATTGAGCGAACCACTTCGTCATTA
ATCGCTGCTGGGATGCCGCTTCTAGATAAAGCCATTGTCGAAGTATTACTGTGTGGTGACACAGCAGATGGGTTATCTGTTCTACCAATTGTCAGTGTTT
GATCGTAGGTACGAGACGAAACAGGTTCGGAATACAGTGCATCGTTACTCGTCTCCCTGGAAAAATTGGCACGAGCTAATGAACGCTCTGAGAGTACTCC
GGTCGAAACTTGAGTTAGGTCCATCATTTGTCGAGGTTCTTCACGTTGAGATAGTTCATATTCAACAGGTCGATATGTGTTACTTCTAGGAGAACAGACT
TCCGCACGAGTTTCAAATTCCTGTTCAGGTTCATCAGTAGGGACGGAGAATACGTTATCTCTCGAGACATTAGGAAGTAAACTTAGAGCCATGGCAATAC
TGGACAAGGCAGTAGTTGATGAGTAGGCGTATTCGTCATCTTCTGGAGGCGGCATCTCAGCACTTTGATGGGCACTTTCCATTAAGACACCGGTTTCGTA
TTGTATCGATGCAAGCATTGGTGCAGAGGACATACCTGGAATTGATAGTGAAGAAATAGTGATTGACACTGTATCGCTTACAGAAAGACCAGTCCCGTGC
TCGCCCGTCCTACTTAAAGGGGCTAACTCAAGGCTTTCAAAATCAATAGGAGCTATTGTCTCCTTGGCCTTGAAGATTTCATTGGTAAGAGAAGATTCCA
CGTTCGACAACGAGAAATTTGGCAGCTTTTGCAACGCCATCGCAATACTTGACAATGCCTCATTGGATGAGTACCCGAAGTCACATTCGTATTCATCATC
ATCTTCCGATTCAGCCTCACCATGAACTCCCACGTTGGAATCAATACAAGCTCCGCATTGGTCTCTACTGGATTGAGTTTCAATAGATTCATCTGATTTT
CTATCACCCGATAATACAAAATGTTCTACCCCAAGTGAGGGAGGAAGAGGATCCATGGTATTCCTAGGCATACGATATTCATAGCTTGATGAATCAATAA
GCTCATGCATTTCCGGAGGCTCCGTGACGTCCATGTTGGACACTGCTGCGGAAGATCCAATTGTAACATCCACTTCATTCGTGGGAGGCGGGCGGTCTTT
GATTGTGAGTATTTCGATGGATGGTCTTATCATGACTTCAGTACCAATAGACTTCTCATCGCACATCTGAATCACTTCATTTCCCATTGACCGCGCTGAA
ATAGTCCTTGCTGATGGTGGAGTGCTGCGTTGGTTTATTTGAACTTCATCCTTGACAGGCTTATTCTCAGCAATTCTTTGTGATCCAGATTTATCAGACG
AGCTGCTTCTGGTGGACACCTTCGCTATCGCGGCCACATCTAACACAGAAGGCGAACGTACATTAGCATCTCCTTGATTTCCAGCACATAGCTTACTTGA
CGTGGTAGAAACTGGTGTGGAAAGACTAGAATGTTCTAATGAGGAATTCGTTCTCACGGAAGCAGGGCTTGGTAATTGTATCCACGCAGATGACGGAAGC
GATGGTGTCCTCGCATCTTCCTCTTTCCTTGAAACACTCTGGACTGCCTCAGGCGATAATTTAGAGGAAGTCAGAGGTTGATAAGGAATACTCGGTGTTA
AGGTCCTTGAAGAAAACGGTCTAGATTCAGGAGGTACATGACTTTTCGCTGTTGGTGAACCAGCCCACGCTTCGAGCAGATCATGCTTCCCTGCCCGAGA
TGATAAAGAATTGTGGAGATCCAACCTTTGTATCCTTTCTTCATCATCTTCAAAGGTACCATATCCGTCATCCCGCCCACGTTGTGAATGTAAGAATTTT
TCGTTGTCATTGTGCGATTGTAAATATTTCGGAAGCATTCGGATAGCATTGAAACGAGTCTCAAGATCCACTAGATGCAGCAATGCAGCTGCCACACGCT
CCGCTGGTAAAATTTGCCAACTTGGGAGATATCGTTGAGTCTGGAGCGCGAATGTTTCAAGTTTTTGCTTCAATAATCGCAACAGTGATGACGATGAAAG
TGATGCTGAGCAAAATAAAGCACCAGATGAAGCTCTTTGATGACAAGAACACAGCAGAACCTCCGATGAGTCCAATGATAATCCATCCACAAAAGGGTTA
CGCGTCAAGTTCACTTCAAAATTTTCAAAGAATCGCTGGAGTGGTGGTGAATACGCTAGAAAATCCGTATCAGACGCCATTTGCAGCAAGTATCTGTAGA
AGTCCTGTTCCAAAATATCGTGCTCGACACCGGTGCTAAACAACTTCACTTCACCGAGCTCACTGCTCAAGTAGACAACTGCTTCCACCACTGCAAGTGA
TAGACTGCGCATCCTGTTCAACAACTTTACTACTCGTTGTGATATGTTTTTCTCTCCGTGATGTGCCCTATGCAACGGCAACACACCCATCAGTTCCTGC
TGTAAATGAGCCATTACTTGGTCGCGTAAGTGGATGTTTTGTCGGACAGACTCGATCACAAGTTGAGCTGGCGACTGCTGTAATGTTGGTGAACGAACCA
CACGTTGTGTTGAGCTTCCGCCGGTATTGTGTGACGATTGCTGACGATAGCGCTGAGATGTCGAACTATTGCGAGTGCCTAACACCTCCTGTTTTAGTTT
GTATGGACTCGAGAGCCGCTTTGCACGATACTGCTGCATTTGACGCTCTGATAGTGGCTTGGTTGTTGAATCTCGCTGGGATCTAGTTAGCAAACGCGGC
TTTGGTTCAGCAACGAAAGTAGCTTGGCCATAACTCAGCTGGGTATAGCGGCTGCGACTTGTGTCTTCAGCGTAACTCGACCTCTTGCCCGAAGAACCGT
CCAGGTTCCACGGTGCTTTGTGTTCCATACCCGATCGTACTGCATCTTGGTACAGCGAGTCATCTAGCTCCAATTCAACTAGAAGACGCTGTTGGTCGTG
GCGTCGACGTCCACCGAGCTCTGTGGCTCGACGCATTGGGGACCTTCCTGAACCCCACCGGAAAGAACGATCAGCCATGCTCCTTAAAATTAGCCGATAC
TTGCCAAGTGCAGGACCTCACTCACACGAATTTCCACTGCCACCTGGGACATTGCTTGAATGCGTTTCATCTGCTAAACCACCACACGTCAAGCAACAAC
AACGAGGTGCAGAGCTCTAGGGCTAGATATAATGCGTGTCTTTAGTTTTACCATCCCACGGTAATCGCAATCAGTTCCATTTGTACCTAGATAAGCATGT
CTTCATCTTCCTCTTCCTCACCATTGGTTACAGTCGTGAGCCCCTGAGCTCGGTACAGATCGGCAATCTAAACGCGCCACAACAAATGCGAGATGTTAGT
GTGCCTTGGTCCGTCATATAAAGCCAATATAAGCTCGAGCGTACCTGAGAGGAGTTAGTCGCTTGAGTGGTCTCCTTGTCGTCGCGGATGCGAATGAAGC
GTGGGAAGCGGAGCGAAATGCCCTTATCTTTCGCTACAAGCCCAATGGCGGCAGTGTACTTCGGCGATATCGACAGGTCTGCACCTAAAATTTCCCATAC
ACAGCTAGCCTCGAACCAAACATCAGGCTTGATCCCGTCACCAACAGCATAATCACTAGGCGCTTTATCCACCACCTTTTCCTTCAACTGGTCGTAAAAC
TGTTTGAGCACTTCGTCAGACAACCCAGTACCAAGTTTTGTAATGGGTTGGTACATCTCGGTATCCGGGTCGTAGCATGCTAGTAGATAGGCGCCGTAGA
CGCCAGTACGCTTGCCACGTCCGTGGAATGCACCAATCGGGACCAGGTCAGCAGAATCGCCGATACCGTCGAGGTAGTCCTTCTTCAGCTTCAACCACTT
GTGTGAACGGTTAGCTGGCTCATACGTCGCCTCCTTCTCAAGGGTCTTTACCATTAAACCTTCACAGTTCTCACGCACAGCCTCCTCCAGGAAATTGCGG
ACCTTGTCGACAGCTTCTTCCATGGCCTCCGTATTATCCTTCACATCAACACCATCGTCGACGTCTAGTGACGTGGCGAATTCGAAGTTGCCGGGCTTTA
CGTCGAACATTTCGCGCAGCTTTTCACGGCGTTTCGCCAGCGGTGTGCCAAGGAATGACTCGCCGTTCAGGAACAGCAAGTCAAAAGCGTAGATACAGAC
TGGGACCTTGATATCTTCCACTTTCACATTCTACAACCGACATGCAAGCAAAGTTAGAGGCGAGCGAGGACAGATAATACACACGTAAGGAATTACCTTT
CGAGAACGCGTACTCAAAATCTGGAAAGGAAGACGCTTGTTTGTTGCTCGATCCACGGCAACCACCTCGGCATCAACAATGCAGCTCTTGACGACGCCGG
CCTTAGCAGAGCTTGAGATAGCCAATTTGACGTCAGGAAATCGTTCAGTAGAATTCTCGAAGTTGCGTGAGAAAATGGCAATTTCTCCGTTTGGAAGAAT
GTGGATCTGTGCGCGTTCTCCATCATACTTGTACTCGCACGTGAATGGTTTGCCTTCGAAACGATCAAACACCATTGCATATGCTTTCGTTGGACGCGCA
AGCATAGGTGAGACAGGTGTACCAGGTGTCAGCACACACTTTTCAGCTACCTTGGCAAAGTCCTTCACACGAAGGAAAGGAGCGCTTGGGACCTCCTTTT
GGACTTCGTAAAACGCTGCGATCAATGCGTTGTAGCTTGGGCACTCTGCAAAGGCCTTTTTGACAAAGACATGAGCTTCCTGCTGTTTGTCTTTGTCCTT
GTAATCCTTGTCCGCCATAAAGGCGTACGTTAACCCCATAAGAATTGATTTTTCTGCCAATCCAATTCGTAGCTTACCCTGGAGCCCGCGGATGATGTAT
TTGGCTCCTTCGGCAGATTGTGCGCTCTTGTCTTGGGATTTCTTTTCTTTCTCGCACTTGACCAGCAAGCCCTTGATAATGGAACACTTTTGCTGCTGTG
AGTTGTTTCCAGTCATCTTGGCAATCTTGACGAACTGGTTGTACACATGCTGAACGGTGAGTCCGCTACCCTTAGAAGTCGCAGGTTTGAGAGATGCAAA
GGACAGTGTTTTCTGCTTTGATCGTGCATTCTGCGCAACCTTACCAAGGTCGCCCTCCTTGTGATACATCTCCTTGATGAACTTAAGATTTGCACCGGTA
GCCTCACCGATGGCTTTCATCAAAATGGCATCACCAATACCAATCTTCAGATTTTCGAAAGGCGGAGCCAGGTCAACACACACGCAGAGGTAAATGCACG
CCAGTAGATCATCGGGCGACCGACGAATGACGTCACGGAAGAAAGCTGTGAGCAGGTCCTGGATGACTAGACGGCCAGTGACTTCTTCAATTTTGGCAAA
TAAGTGTGCCAGAGCGAAATAGGGGGTCTCCCGAGGTTCATCGCCATCCACATGTAGCATCTCACTCATATCGGCCTTCTCCTTTATGCTCTTTGTCTCC
GACTCAGGATCATTTTTGAGCTTTGAATCTTTCGTGTTGTCAGCTGATGTCGACTTGGTCTTGCCCTTTTTGTTCGAGACCGGCGTGAAGAAACCCGTTT
TCGATGCAGCAGGTGACGCAGTTTCTTTTTTCATATCTGCTTTTTTAAACTCCTCCTTTGGCTTCTCGTTTTCATCCTCTTCAACCTCTTGGACCTCTTT
AATCTCTTCAGTCTTTTCCTTATCACTGTCAGCGTCCTTCTGTTTCTTGATAGGACTAGTAGATGCCTTCGTCATCGCCTTCTTGGTACTTTTAGCCGCC
TTCACTGGTGTCACCAGCTTCGCCTTGTTCTTCTTGGGACTCTTAACCTTCTCCGGCGTTGATGTGGGCGACGTCATATCAATCACGTCGTCCTTAGCAG
CTTTCTTGTGTGTGTTCATAGGCAGATCCAAGTCACTATCTTCGTCCTCTTCTTCCACGACACGTTGACGTAGACGACGACGACCAGCTGCAAACGTCAA
CAACGTTAGTCAATCAATCTCATCCTCTCCTGTCATAGCCACGTACGCTTCGTCTTGCTCTTGACTTCTACTTCCTCCTCCTCTTCCTCCTCTTCCATCT
CAATATCTTCTAGTTCTTCTTCCACCTGCTCCTCTGTCTCTGCTACTATTTTCTCCTCTATCGGTGTCTCTTTTTCCAGCTTTGGTTTCTTAACTGGCTT
AGCAGGAGACTCAGCAGATTTCTCTTCATCATCTTCTGCAGGTTTCCGTTTTGTTGGCGGCGGCGTCGATGATCCAGCGCCGAAGAACGACCTATTGTAT
GAATAAGATTAGAGAGGTTCACGATGGTCGAGACACAATTTCACGTACATGATGGAGCGCTGCTTGGGCGCAGCTACGTCATACACAAAACAAGATGTCA
GTGACATCTCGACGCATCTCCCATCGCTTAGCACGTACCTTTCTTCGCCATGGCGCTCTGACCGAGCTTTTCTGCTACTGGCATCCAAACCTTTTGGCGC
CAAAAGGATACATCAAGTGTACACAAGTCTATTTTTGTACCCATGTTGCATTCAAGTTTTTGGCGGGAACCATCACTCTTGTGATCTTCCAGCAACAAAC
AGCAAATGGGGCGCAAGTTGCTTGCGCTGGTGCCGTCGGCATTGCCGTCGTCTGTGAACTTGGGGCGCTTCCACTCGGACGCAACTGATACCCCTTTCCT
CTCTGTCGTGTCATGGACCTGTCGCTCGACAGTGGACTCGACTCGCACGCGGCAATTGGCACTGGACAAGGACAAACGGCAACTTCTGGAGTTGCAACGT
CTGCAACCTGACGAAGGTGCGCGCAGCTGGTTCGTCGGCAACTCTGTGTTGCAGGATGGAGGAGTGATGGTCTTCTCGCCAATTGACGCACTCTTTGTGC
TGTTGGATGCCGCATGGGCTCAGCGCACACGTTTCATGTCAGTCTATGACCTGCTGGCGAGGGACGGTAATACCTGGTTGTTGCAGCTCTCGACGCTCAG
TCAGGAACAGATCGAGATGATCTGCGATGTGCAGCCAGTAGGTGGAGAGGAAGGTGTTGATAATCTCTATGTGAAGGTTAATGAGAGCAAGACAAGGAGT
TGGTTGAAGACAAAAGTGGAGAAAGTGGCGAGTGTTTTGGCCAAACAAGAGATTGAAGCCAACTCCAAAGCTGCAGCTGCTGCTGCAGTTGATGCGCAGG
TGAATCTCCCTGGTGTCCAACACAACGAGACAAGGAAAAGGGAGATGGTAGGAGACGTTTCAGGACATTTCCGTGAAGCTATTGACATTGTGGGCAATTA
TCTGGCGAACGAGTGGATCGACTTGCTCTGCAATGAGTTAAAGTACGTTAATGTGTGTGATTTGTGATTATCGAAGTTGCTGACGATAGTTTTGAGTGCA
GGGTGAAGAAGGAAGTGGATGTGAAATCTGTCACAAAGACCGCAAGCGCACCACTGGACACTTTCAAGCGCTTCGATCGACGTCAGACACCAGAAAATGG
ATCGAAGCGACCGACACCATCTAGTACTGGTGCCGCCAAAAAGAAAAGCAAATTAGCCAATGTGGATCGCACTGGAATGAAGTCGCTCACTTCGTTCTTC
GGAAAAAAGTAGTGAAAATGATGCATTAGCGAATATATAGAACTGTTTATCGTCGTGAGATGGAGCCTTCCACACTGACCCGATGCACAACAACGAAGTC
ACTCCAACCGGAGAGGATCTTGAACTTGATAAAGGAAGCATCCGTCGGTTTAACGTTTTCGCTAACAATCTGCATTTCCCCGTCAGTCTCTTTCAACTCT
GCAAGAGAACGAATAAGGTTAGTAGGGTGAGTCATTTGTAGCATCAACAAGTTTTGTTGCTGTTTACTCGTATCAAAAAGCTTTTCCCATTTCGTAGGAG
TCGGTCCGCTGCAAGATTCTACAGACACCTCCTTGATATTTCGTGCCCACATCTTGGCACGGACCACTGAGGCCGTCGTAGCAAGCTGAACCACAATTTC
CTGGGGGAAGCTTCCTGTTGTCACCCATTTGGATGATTGCTCTCTGTTGGTAAGATAGCAACATATCATTCAAGCTTTGTCACCGATTTGCAAATTGCAT
GGTGAGACATACCCATCCAAGATATTGACTGGAGGAAAGCTTGGGTCAAACGAAGTCACGGCTGTCACCTGGGCACCCTCTTCATCTAGGGCGAGTTCCA
TCACGAGAACAACAGAAACTCTTTGCAAGTGTTGCTTGACCTTCCACTCTGTAGGTCATAAAACTGCAGGGCTTAACTTAGAACAACGCAGCACAAAAAA
ATTCAAAGCAACTGAAGGCACGCACTCATACTTATCATCTCGATTTGCGCTGCGTAGTACACACTGCGACTTACTTGAACACTCCTAGATACCAACGTCA
CCGGTGACCGGTCATACGGGCGCTGTCGACCCAATTCAAGATGGTCAGATGCATCGCCCATCAATTCCGCAATCAGTATTCATTTCATGATGTCAACGGC
GGTACAATAGATTCTTTATACAGACGCTCAAAGCCCGCCGACAGGATATCAGCCGCACGTGTAATGCCTGATCCATCATCATTGAATAGCTTGCAGTTCG
ACCACATCAGTCGAATATCGTTCGCGAAGTGCGTACAATCCAACTCTTTCACACCTGACGCCACTGTGTTGCTGTCCACGATGTACGCACCCTTCTTCAG
CTTGATCTCAATCCTTGATAAATCCATCGGCTGCTTCACCACCCGAGTGTACATCGGCACATTTTCCACCGGCGTCAGGAACGGCTTCGAAAATGGATGC
GACTTCAAGCACTCGACAATTTTCAGGCACTTGTCCAACAAACTTTGTTCTGAAGCCACAGCAGTGGAATACGCATCGAACCGCGACGGCTTCTTACATT
CGTCACATTGCCAATCGCCCTGAGGAAGGTCATTCTCCGTCATGTTGAGGCACTTCAAATGGAAAGAACGCGGGCACTTGTCGCAACAGACCAGATCCCC
AGCACCCTGGCAAACCTCACAGAAATCCAAGTTCGCGTCCAGTTCGCTGTCGGATCCACCGTCTTCATCCTCATCTTCGTCTTCCTCACGGTATACTTCG
TCCTCCGTCTCGTCATCGTCATGTTTCACTGGCTTAGGGTGCTTAGGAGGCCTACCTCTTCCTCTCTTTACAGGCTGAACAATTTTAAGCTGTTGTTGGT
TCTTCCTTGAAACCGCAGGAGTACCATCCTTGCGGGGACGCCCTGGTCCTCGATGCGGAGGCGGAGGTGGCGGCATTGTCGATACAGAACGGTTTTCCTT
CATCTCAAACTTGGACAAGCTATCTTTCACACGGCCATCAGACTTCGCGTTAAGCATCGGGCTTCCATCAGATTGTCGTTGGCGTTTATCCCCAACATTA
TGTTGGCTGGCTGTGGTTTCATCACGTGGTGCCGGTATCCGAGAATCATTTCGTGATAGATATATCATCAGAGGAACGTGGCGCCGCCGGACTGGCCTCG
GTATCGCTTGCACTTGCTTTTCGCTTTCGTGACTGGTTCTCTTCAACAGGTCGGGCGCCACTACTCGAGCGATCACGACGAGGACTGTCACCTGAGTCTA
TTGAGCTAGTAGATGATTCGTCCTCGTACGGGCTATCATCTGGTTCGCGACGTCGGCCAAACTCCCGAGGAGACGATTCCATTTCAGTATCATCCGAACC
TTGGGCATTTCCACTGCTTTCGTTCCTTGGTTCAGATCCATTCGTACCATAGCGTGATTCGCTACTATTATCGTTGATAGACTGGCTTTTGGCATCCATT
GCCGTTGAACTTGCCAGGACTGCACCTCGATTTAGTGAAGTCAACGCATGTGCTAGAGTTTCGTCGAAATTATCACAGTTCGGCATCGCGCTCCCCACAG
ATGAAGACTCGACAGAGCCTTGCTGGTCGTGAGGCGACGCGGCTCGAGGTTCAGCAGCTTGAGCACTACCCACCTTAGTAGATGGAACATCAACAGGCGT
ATCCTTTGCTGCGCGCTTCGGAGCAATCGGATACTGAACCGAAGACTTTGGCTGGGCCTGTACGCTGGGATCATAATCGTCGCGGTTATTTTGCTCATCC
GCCGGGTATTGTGCATATTCAGGCTTTGGGGTCTGCATTTGTCTGCGTCCATCAAACGCTTTTTCTGCTTCGGTACGACGAATAGTGAATCCATCAGGCT
GAACAGGAGGACGACCATCAGCTGAAGATGTGGGTGGGTACTTTACGTATCGGCCGTCACTGCCACTGATGTTCTGGGTATTGCCATACGCTAATCGTCC
TTCTTTCACAGAAGCAGTAGTGGCTCCAGTTACGCGGTCATTTCTCGCAGCAGGCACCGAACCTTGTCCATTACGACGCAGCGTGTCTAAAAGATAGCGC
TTGTATTTCTGCACTTCTGTCTCTTTTCTCGCTGTGCAGCCAGTACACGGGCACCCACTCGTACAAACCAAGCACCGCAGCAAGCGTCGGTTCGGGGCAG
ATCCGTTCCTACCAACAAATAAAGCTTCCATCCTCACTCTGTAAACGCTGCGCAGGTGTTCCCGACATAGCGAGTGGTTCTCGTCCGCATGCGGGCAAAA
GTTCACCACAGGAACATAATGGTTTTCACTCACTCCGCACAAGTGACACAGACCCTTCGCCACAAAGTTGGCTTCCCGTTCCGGAATCAAGTCTTCCATT
GCCACAGCAAATGCATCGTGTAGGACATTTTCGTCCAGGCTCACCTGCTCTCTCAACATGTCTTCCACTCTCGGAGGCAACTTCCTTTCTCTCTTGTAGT
CTTCCGCCATCTTCCCAGAAGATGAAGTATCCGTCTTTCCTTGGTATAGTTTACCACTAGTAGACTCTGATCCGTCCACGACTCTTCCCTGGAAACCAGC
AGAGGTCTGTACAAGTCTACCCTGATACGCCGCAGCACCAACCTGCGGTCTACCTTGATAACCTGTAGCTGCAGCGATTGCTCTCCCTTGATATCCCGTT
GTTCCATCCATCGCTCTACTCTGATAACCAGCCGAACTCTCCGTCGTTCTTCCCTGATAAGCAGTAGAAGTGGGCACCGTTCTCCCTTGATATCCTGTCA
TTCCGTTCACAGCTCTCGCTGAATATCCCGTTGCTCCATCCATTGGTCTTCCTTGATATCCCGTCGCTCCATCCATCCGTCCTTGGTAACCTGCGTTCAT
GGTTCTTCCTTGATAGCCGGCCGAGCTGTCCACTGCTCTCCTCTGGTACGAGGTAGGACGTTCTACCATTCTCCCCTGGTACCCAGAGGCAGAGGTAGAT
GTAGAGGTAGAGTACTGCTGACGTTGCATGGACACTGACGCTTGAGGCGTCGCGTCCCAGTCTGGAGCCGTTCTCGCTCTCCCCTGCCACGCCGCGGCCG
ACGAAGTGGCGGCACCAGTCGCCGGGATGGCGGAGGCAGGGATGTAGCCATCCGGCGTCTTGCCCTTGCTCATGATGGCTTCTATCCACACTTCATTGGG
CGGGGGCGTGAGTCGCTGTCGCTATTATCGTGGAAAGTTATATCAACATTAAGGAGGGGGAAATAAGGTTAGAGAGGAGGAAGAGAGGTGGCAGGGGCGT
AGAGAGAGTCGCACCTTGTCCCCGCGGTCCCGAGCCGCCCCATGGTACATGCTGGCGCTTCCTCGCTGAGGCGTCGACTGCTTGTCCTGCCCAAGGAGTC
TTGAGATTTGGTACACCAGAGACTGGGTTTTGGCGCGATTCGAGTCTGCCAAAACTGATATATCGTGTGTGTTTAGTATAAAATGGTAGAGGTGCCCATC
TCAGTTGGTGCCTGGG