Description :
From Genome Similarity Track
Location :
Scaffold_1139:931- 1982
Transcript NameFunction/comments
Phymu_g12805hypothetical protein

Sequence
1051 bases(100 bases per row)
CAAGAATGGATGCTGCAACAGaccgccttctccatcaatTGGCGGTCGTAGACGATGGTCCCGCTGCAAACACGAGCGAATCACATCTTCCAGGTCCTTG
TTCTGCAATGGCGGAAATGGGATCGGAACTGAAGGATCAATGATGCAACGGAATTTCTCGATGATGCTGGGAACGTCGCCGAATGGTGGCTTCGAGTACA
CGATTTGGTAGAGAATGCACCCCAACGACCAAATATCACTTGCACGACCGACCTAGAATCACAATAACGGTGTTGGCTTGTTTGTTTCCACTTTGCGATG
GGTTGTATCAGACGTACCTTCATTTTCCCCTCAGGGTCACGCTGACCGTTAGGTGCCGTGTTGCCCTGAATCGCCTCCGGGGACATGAAATTGACGGTAC
CAATCTGGCTGTCACGCTCGATGTTCGTCGTGTCGTTCGAGATTGTCTTTGCGATTCCAAAGTCGATCAGTTTCAGAGCACCGTTCACAAACAAGAAGTT
GGCTGGTTTCAAATCACCTAGTCCGACAGAAAtaaaacacacacacacaagtAAGCAAGGCAACACTCACCACATTTACTATGGGTCACGATCGTACCGT
GAATAATGCGCTTATGATGAATGGCGTTCACAGCTTTAAGCATTTGAGACCAAATCACTCGCAACATATTCTCGTCCATGTCGCCCTTCAAGGCGCTAAG
CCGCTCGCTGAGGTCGATTTCGCCGTGCTCCATTATCTAATGCGCGATCACAAAAAGAGTCAATCAGATATTCATGTATATACAGTACCATAAGGACATA
CCACATTGATCTGTCGCTGTTGGAGgtcttgttcagcagcaatGAGCCTGATGATGTGCGGGTTTCCTTGCAATTTCTTCAGAAGATTGATCTCATTAGT
ATACTGGGCAATGCTTTGGGCATCCAGTTTTTTCAATTTGATTTTCTTCAGCGCGTAAATCTTGAGGTCTGGTCCCAGCATTCGGTAGACTTTACtactt
ccaccacttccgatctgctccagcttaATGTACCTCTGCCCATTGATCTAC