Description :
From Genome Similarity Track
Location :
Scaffold_151:93091- 94859
Transcript NameFunction/comments
Hyaar_Emoy2811256ubiquitin 1, putative
Hyaar_Emoy2811257ubiquitin carboxyl-terminal hydrolase, putative

Sequence
1768 bases(100 bases per row)
CGGAATGCAAATCCAGATCAAGGTACGAAGTCACTGCAGTGTGTGTGGAGCTGTGGCGTGTGGTGAAGTGAGCTAAAAGGTGGTTGTTTGTGCTTTTTGT
TGTGGACATAGACACTCACGGGTCGAAAACAGACGTTCAACTTTGAACCGGACAACACGGTGCGGCTATATTTTATTTGGAAAATATGAACTTTTACTAA
AAAAGCGCTTTTAACGCTGACCTCCCCTTTGCTTTTTTATGGAATTCGGCTGTCAAGATTTTGCACGTGAAGCAAGCTTTGCAAGAGAAGGAAGGCATTC
AAGTGGACCAGATCCGGCTCATCTACAGTGGCAAACAGCTGTACGTAGTCAGCCTCGATGCAGAAAGAAGAGCCTCTGCTAAAAGGGGGCCTTCCTTGTT
ATGTACCTTTTCTGTAGAGCGGATGACAAGACGCTGCAAGATTACAATGTCGAACCCGGTGGTACCATCCATATGGTGCTACAGCTGCGTGGCGGACGCT
AGAAGACCAGGCGTCGAGTTTTCGTAGATGCTGATCGAAAGGATTCACGCAGTTAGAGTAACTTGGAAGACCTCTTGCATCCACGAGCTAGGAGCACTTT
GTTACAGTGACGGCAACTCGCAGTTGGAATGATCGAATTTATTGTTCGCTCTCTTCTGTTCTCTCTTGTCTTACGAAACGTTCGTGGAGTTTGTAGCAGC
AGCAGCATCGTTGGAAGCATCGAGCTGTTGCTTGATCAAGGGTTTTAACTGCTTCTTCTCGGCCAGCGTCTTGAGCAACTGGACGACGAGTGGAATGTAG
TTGTGTTTGCGGCGCTTGTTCTCCAGGGCCCAGTTCTCACGCTTCTGTTGCTCGGCTGCAAGGTCTGCGTGGATCTGTGCTGCGTGCTGCTCACTCCCGC
CAGTCTCAAGGGTCGCTTGAAGCTGCTCTTCGTACGTTTGTATCCGGTCACGCACGAGCGCTAGCAAGTTAAAGCGGATCTCGGACTGCGCGTATTGTTC
GATCCGTTTCTGGATCACCGGACACGCAACCTGCAGCCAAGACTCGTGCTTGTCCTCATCGGGTACATTGCCGAGATAAATGGGACCTTCTTGGAGCCCA
TCCAGCTCGTACACCCTTCCATTCAGTGGCACGTACGCTATAAAGTGATACACCTCGTCGCTTCCTGTCGCCTTCCTCTCGTCCTCGACAAACGGTTCCG
CTCGCGCAAAGGAATTGTGAGCGAGTCGAATCTTGTCGCTATTGGAGATAGCAAGGCCCTTGAGCTCCGGCGGAAAGTCACTTGTAAAGGCCTTGAACTC
CGACAACGTCTCACCCAGTTCAATGTCGTGCGAATTGAGCAGGATGGACAGAATGGCTTGTGTGGCGCAGGCGTTACTGATCACTTGCTTGGCAAAGAAC
ACGCCATCCTCCACTCCAGTCAAAACTGGACGCTCCGCTTTATCCGCGTGAGTGGACTCGTACTTAAACAGAAACACGAGGCCGTAGACGGGGAGTAACC
CGGCAAACTGCTGCTCATCCAGTGAGTAGAGCTCCTCGACCTGCACGCCCTGTACGCCAATATCTTCAATGAGGGTGGTGAAAACACCTACACAAAAATG
AGGGGAATAGGGGGAGAGTGAGAATGGCTACAGATGAGAGCAGCATGGAATAGTACATGACGATACACGAAATCTACAGCTTTAGCACGGAGATCGCTAC
GAACGATCGACAGTGGCAACCACAAACTTACCAGGATCGGACTCGATGGTGCACCAGGACATTTTTAT