Description :
From Genome Similarity Track
Location :
Scaffold_1:930863- 931977
Transcript NameFunction/comments
Aphas_H257_00335initiation factor, subunit 2 family protein

Sequence
1114 bases(100 bases per row)
CCGGATACACAATCAAGTATCCAGCATTTCTGCCAAGACCACACCACTGGAATTTGCAGCCTTTGCAGCAATCAAAAAGCATGGCTGACCCGAGCGACTT
CAAGGAGCTAGGTACGTACATGCCTGCGTGTGAGAAGCTTGCACCATGCAGCTCTTCCGTCTCATTAGGCGGTGTGTTATGTTGATGTGCTAATGTTGTA
GAGAAAATGCTGGACAAACAAGATGCCAAGAGCAAAGCAAAAAAGTCACCATCCGTCGCCCAATTGAAGCCAGACCTTGCGGTACATTGCACATATCCCT
TAAACAGCTAGGTTACACTTGTGCATAGGCTGGCATGGAGAAGATTTCGCTGTCGACGGAGGAAGGTACGTGACGAAGGCCAATGATTCACATCAACCGT
GACGACGATGGTTGGCGTAGACAAGGCGGCTCGGAAGGCAAAACTCGCCAGCCAAACGTTTGAAAAGAAGCCTAAACTGACCAAGGAAGAGCGCCGCGCA
CAGCAAGAAGCGCAACGACTGGCTAAAGCTGCCGGCGCGCCTGCCAAGACCGCACCGAAGGCCGCTGCGGCCCCGGCTCCACCCACTGCTCGCATGCAGG
TATAATAGTACCTTCCAAACTCTCTCACTATGATAACTTCACTCGTAGTACGACGACCCTAAAAAAGTTGCCAAGTACTCGAAGAGCTCTGTCATCCAAC
GCACGCAAGCCCAGAAACAAGTAGGACGTCTCCGCCATCGTGGGGTTTTGGTTGATTGGATGATTGCTCACGTTGCCATGTACCAGGTCGCGCTATTTTC
GCATTTGCCCCAATTCGAACGCGAAAGTTCCTTGTCGTTGAACGTCGGGTTTTCTAAAGTACGTAGGGGTCGCCCTATATATTGTCGTTTTCACCCAAAT
TTGGTTGATTGGTGAAATGAACTTGGGAATCTCAATTTAATACCATCCAATGTATACTATAAACTATTGCATATGAAATCTTCGACTGGGACAAATGGGC
CAAACATCCGTGAACTACCATTGGTTAGAATTTCTGATTGAAACGATTTCATTGGCTAGTCGTTTGGGGGATGCCGCTATTCAATTGGACTACCCACTCC
ACCTTCGAATCGAG