Description :
From Genome Similarity Track
Location :
Scaffold_1:930846- 932866
Transcript NameFunction/comments
Phyra_71049cyclin-dependent kinase, putative
Phyra_72856AhpC/TSA family Redoxin, putative

Sequence
2020 bases(100 bases per row)
GCGTCGTGTCCAAAGCTCGGGACAAGGAAACGGGCGACGTGGTGGCCCTCAAACAGGTCAAAATGAGCGCCGACGCCAGCCAGGAAGGATTCCCGGTCAC
GGCGCTGCGGGAGACGAACGTGCTGCTGTCTCTGGACCACCCAAACATCGTCCAAGTGCGGGAGATGGTGGTGGGCTCCACGCCCGACAAGATCTACATG
GTCATGGACTATGCTGAGAACGACCTCAAGCACGTTATGCAGAACAAGATGAAGGCTCCGTGGCTCCAGTCCGAGGTCAAGTACCTGCTGCACTCACTCC
TGAGTGCTATGGCCTATATGCACGACTGCTGGTACATTCATCGAGACCTCAAAACCAGCAACTTGCTGTATGATGCACGTGGAGTGCTGAAAGTGTGTGA
TTTTGGACTTGCGCGCAAGTATGGCTCGCCGCTGCGTACGTACACGCAGCTGGTGGTGACGCTGTGGTACCGCTCCCCGGAGTTGCTGCTTGGTGCGAAG
AAGTACTCGACGGCGGTGGATATGTGGTCAGTCGGGTGTATTTTCGCCGAGATGCTGCTTATGAAGCCGCTGTTTGCAGGACGTGGTGAGCTGGACCAGA
CCGACCAGATTTTCAAGCTGCTTGGCGCGCCAAATGAGGAGAATTGGCCTAGTGTTGACGATGACGTACCGGATGCCAATTTGAGCATTCGGGGCAAATG
GCCCAAGCATTCTCGACTACGTGATAAGTTCCCGCTCGCTGCAACGTTTTCCGGTAGTGGGTGCTCGCTGTCGAAGGCTGGTTTCGACCTGCTGAGTCGG
ATGCTAGCACTTAGTCCGCGCAAGCGAATTTCAGCCAAGGACGCACTCGCACATGAATACTTTCAGGAATCCCCCCCACCAAAGCAGCAGGAGTTGATGC
CGACATTTCCAGCGTAGAACAAAACAAAAGCCGCGAATCCACCGCACGTTACTTGTTATCACTCCGACTTGCTTTACTCGCTGCAGCCGTCGGTCTGCCT
ACACTTGACCACACGCAGCGCCACCACCGTCACTGAGAAAATCAACATACGCTTGGTCTTCAAATCGACTCGGTAGGAATGCGTCCACGTGGTCAGCAAG
CCCACAGCCCTCGAGTTTCTCGCCCATGACCTGCGTCGCCAGCAAGTGGCCTGACGCACCACTGGACATGAGGCCAACACCAGTCATAGCAGACTGCAGA
AAGATGCCTCCAATAGTACTCGGCGCCGGCCCGATGAGAGGGAGGTTGTCCAGTGTTTTGCAATAGTACCCGCCACTCACGTAGAATGAATCGCGCACTT
CCGGTCGCGTAAGGTAAGACTTCACCTGCGGGAACATCTTGGTAAGTCCGCGGACACAGACCTCTGGGAATCTAAAGCGAAATGACAGTCAGTATCAATA
AACATGCGTCCGGGCAACAACTCACCTCCGATCCAGTACGTCTTCAACGGGATAGTGCGCTGGTACAGGCTCGATATCGTACGTCCAGACTGCCATCATT
TTATCCCCATTGTACGGCCGCACATGAACTCCGCCCGGGTACTCTTCCAGCATGCGAGCTGCTACAGGATCAGTCATAAGCTCCTTGCGATCAGCGTCTG
AAATCTGCAGCAAAACAAACAGCACAACGATGAATAAACTCCTCATTCAGAGCCATCTTGAAACCCTTCACACCTCAAGTTTGCCCATTGGGTCCGAATC
GAACGTCAACGGCATCGTAGGTGGCAACACATGGTCGACATCGTCGACAATAGCGCGGCAGTGCAGCTCGTTAATAATTGGCACATCGAAGCTCGACATA
TCGCGCTGTTTGAGAATATCCATGGTTCTCTCAAATAGCGGACCCGTAGCAAAAACCACGTTGGGTGTCGCCACCTCCAGCGTTTCGCCGTTGTGCATTG
CCACCTTCACGCCACTCACATTGCCTCCAGTAGCAAAGAAATCGGTAACTTTGCCCTGCAGCACGTTCGCCTTGGGGCAGTACTCTGCTGCCTTAGTGAG
CTCGTAGTCGGCCACCTTAA