Description :
From Genome Similarity Track
Location :
Scaffold_11:930695- 935862
Sequence
5167 bases(100 bases per row)
CATTGCCTCGGCGGACCTGAAACCAGCACCTCAATCCCTCGTAGACTCGGCAGCCTCCTGCCACATGAAAGCCAAATGGGCAAGACTGGAAAACGTGCAG
TAGGCGCCTCCCTTGGACGTTATTATCGATGATGACAGCAAGGTTCTCGCGAACCTAACCGGATCCATCGACATACCCGTGATTGCTACACAAGATGACG
GTACCGCAAGACTGGGTACACTTCGCCTAAACGATGTCGGTTTTGTGCATTAGCTACCAGGAACTCTAATCTCGACCAGCAAGCTAGATGCGGAAGGCAT
ATCGGTGACAATTCGTCGCGGTACATGCATCGTACGCAACCGAAGTACTGGCTTCGTCGTGCTCACTGCCGCAGAGGAGAATGATGTCTTCCCGGTACTT
CCAAACGCTGAGAGCTCCACGCCAGCATTCATCAGCCTTAGCATCGGAGACACCCTGCAGAACTGGTACAACAGGCTCGGCCACTTTAGCACGCGGGCGA
TTAAGCACACGGCATGAGCCGGCACAGTTGAGGGGCCCATCATAACCGACTACAAATCTTTCAAGTGTTTGTCGTGCCTGTATGTCAAAATGACGCGCGC
CTGATCAAGAGACAGCGCGTGTCGAGCGATGTATGAGCGGTGCAAATCTATCACACTGATCTGTGCCGCCCATTCCACCGTTCTGTACATGGCAATAAAC
ATATCATGCTGGTTTCGTGGCGGAACTACGCGTGATACTATTTCTTACAGCTCAAACGCGACGTGGCTCATTGCGTTGAATCTTCATGGAAATTCTGGAC
CGCCAAATATACATCGACAAGCGTTCATTAAAGGTACTTCGGTCCTACGGCAGTGGCGAATTTATTGACGAGAAATGCCGCCAAGAGTGCCTCAAGCGTG
GCGTACTGCTGCATTTGGTCAACTTAGATTCGCCGTTTAAAAAGGGTATAGCCGAGCGTGCCAACAGAACAGTGAACGACATGATCACAACAATGGTGAT
TGACGCCAAGCTGCCACACACTCTGTGGGAGTATGCTGCCCGTCATGCCGTGTATGTCCACAGCCAAGTGGCGGTTACTCGTAACATCTGAACAACAACA
AACGGCGTTGCGATTCGTGCCGCGAGGTCTACCCGCAGTGTCCATCGGTTTCCAAGAAGACCGCACAGGAACTCATGCCTACACGCAAGAGCCAACTGCA
AAGGTCTGGCATATCCGTGACTTCGAGTTCATTGCCCCTGTCGACAGCAGTAGCGTAGGATGCCAAGTTCCGCTTACGCAAGATCGAAAATGAGAGGATG
CCGGCAGCGAAGAAGACGCAGCACCCGCGCCAACTAACTCAGGCCAAAGGCGCAACCTACATGGCGGCTTGCCTGCAGACGTCGTGGTAGAAAGCAACGG
CCAGCCAAATCTCAATTCATAAAGTGTGGAACGTATTTCGGCGCGGCAAGTAGGAACCGCCCTAGTTGCAGCTGGAGAAGTTGTCCGCTAGCCGTTGAAC
ACGAGTGAGGCAAAACACAGCAAGTGATGGCCGCACGGGCAGAAGGTGATCGTTAGAGAGCTGAAAGCGCTCGAGGAAACCAACACTGGGGCGCTGATCG
AGCTCCCTCCAGGTGAAACAACACTAGGCTACATCCTCCAGTATCGACTGAAGCATGACGCCAACATGGAGCTGACCTACAAGGCCCGCGTGCGCGCCAG
AGACGATCGAAAGGACTTTGTGTTCGGTGAAGTGGAAGTATACGCCCCCGTCGCGAAGCTGGCTTCATGTTCGCGATCGTCGTAAACTTCGGCCTCTGGA
TGTGCCCCAAGCCGGCCTTCCCAGTACATACGTCAAGGACCCACTGAAGGAAACGGTGTATCTTTTACAGGTCAAGGGGTTTGAGGCGCCTGGCCGTGAG
CACTGCGTGTGGAGGCTAAACAAAGCGTTGTACGGATTGCGTCGATCCGGAGCCGCGTGACACAAGGAGATGGACTCGTTCGTCTGCATCATGGACTGGA
ACCGACTCGATCCAACCCGTGTGTACACACGAGCACCAAGGCAACGCGTAAGATCATTCTTGCCCTCTATATCGACGATATCCTTATTGCCTACAAGAAT
CTGACCGAGATGACACGGCCTCGAGGCTAGATACAGCGTCAAGAATCTCGGAGAACCAAAGCGGAGTCTGGGTATGTCGGCGACGTAGCGAAGCGTGCGC
CTCAACTAACACGTGCAGGTCCGCAAGATACTGCACAGATTTCGCATGGAACACACACACACACACTGACACGGGCCTTAACCGATCACCAAACTCGATG
TACAAACTCGCAGCAAGAGCACGAAGCAGACCTCCCGCACGCTTTCCACATAGTCATGACAGTATTGGTGGTGGCAGATACTTTTTTTTACTGAAGTACT
TTGCCTTGTAAACTATGCGCTAACTTGGCGTTCTTATTGCGCTTGATGAAATAAGTCGTGGAATCCAGGAAGCGATGGCTGGTCTTGCTGCGATGGGAAG
AATGGTCGCGTTGGCCCCGTTGGGGTAATTATTGCTTGCGCACTGGCGGCATCTATCTCCGACATCTCCCATGTAGACAACTCTCGCCGGTTCCCTTGCG
GACCTGCACCTTTAGAAAGCCTGGTAGCTCTCGTGCTCTTCCTTTTTACCGTCTCCTTCGCCTTCGGTTTTTCGATTTGAGGCTCACGAAGAGCCTTTCG
TTTAGCTCCTGCAGCTTTCCGTGCGGCTACCTTGGCTTTTGCTTCATTAGCCTTGGTACGTGCTCGCTCAGTACGAAGGTCTTGTATTGTGTGCGGGGAT
TTTGTACGTGGCTTGTCAGGAACTGGTGCAAGGCTTCTGTCGACCCACCAGTGCGCATGGAAATCACTAGGTTGTAGATTCTTTCCAGTCTCGAGAAGTG
ACTTCAAGTGGTGGATGCAGGGTAGTCCTGTTGTTCTAGTGTATGTTCCTGAACAAGGCCGTTCCGATGCTATGTTCTGGATGAGCTCTGCACACTTTTC
AGCGCGTGATTGTGGATCTTCAACACGACATCTTCGTAGACACCCTTTCTGAAGGCGGTCAGTATGCTATCTGTCTCGGAGCTGACGGCGTGCTCGTGTT
TTTCGATGCTTTCAGTCCACCAACGTACCATTGGCTTATATATAGTGAGTAGATCGGATGTGGCGTTGCGAAGCCATAGTTTCATTGCAGCGTGGTAGCC
TTCGACTCGAGATGTCGACTGCAGCCCCAAATGCGAAATCGAGTTTGGTCATCATATTACAATGCAATATATCCGGATATAGAGCCATGTTGCATCAATG
TACTTCGCCTCAATAGCGCGCAGAGTGGCGAGCAAGACGAGCTACGAGGCGCTAAAAGCGGCAGCAGCTGCGAGTTTGCGCATCGAGTTTGGTGGTCGGT
TTCGAGCCGTGGAAGTCTGTGTGTGAGGAGTGCACGCATTGGCAGCGCGTGTGGTGGCGTATGTGTGCGTGGTTGTGTTTTTCCGCGTGTTTGCGTATTG
TGTGCGTAGCGCTGGATTTTGTTGTCTTTGGTTTTGTTGTTGGTTAACCCGTCAGTTTGCCCGAGTGGTCTAAGGGGTTACGTTCAGGTCGTAATGTTTT
CGAACGCGTGGGTTCAAATCCCACAGCTGACATATCCTTTTGCTGCAAACCGCAAGCCAACGCTGCAACGCCTCCTGCGCGCGCTGGCGCCTCTCTTTGC
CCGTGCATCGGCCTGTCGGCTCGCCCAGCACCACCGCGCGCTACCATACCACTCAAACGACCCGTGTCAAGTCTCGACAGCTCGATCCGCCGGTAACGCT
TGGCCTACACGCCGACCTCGAGTGTCCGTCGTCGTTTGCCCTGCCGCCCACGATAGCTAGTCGAGTCAGCAACCCGCTGCGCGCACCTGTCCGTACCGTT
GGCACGCGTGCGCGAGGCAACTGGTTGCCAAACCCGGGCCATACTGGGACTCGATGCTGGCCCGGGTGGTGTCGGCCACCCCGGCGGTGGCTTGGTGACG
ATGATGGCCCGGGTTTGCAACGTCGCTGTGGGGCATACCATCGTAGTCGGCAGGCGTCCAGGGCGCGCGGAGTGGCGAGCAAGACGAGCTACGAAGCGCA
AAAAGCGGCAGCAGCTGCGAGTTTGCGCATCGAGTTTGGTGGTCGGTTTCGAGCCGTGGAAGTCTGTGTGTGAGGAGTGCACGCATTGGTAGCGTGTGTG
GTGGCGTATGTGTGCGTGGTTGTGTTTTTCCGCGTGTTTGCGTATTGTGTGCGTAGCGCTGGATTTTGTTGTCTTTGGTTTTGTTGTTGGTTAACCCGTC
AGTTTGCCCGAGTGGTCTAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACATATCCTTTTGCTGCAAACCGC
AAGCCAACGCTGCAACGCCACCTGCGCGCGCTGGCGCCTCTCTTTGCCCGTGCATCGGCCTGTCGGCTCGCCCAGCACCACCGCGCGCTACCATACCACT
CAAACGACCCGTGTCAAGTCTCGACAGCTCCATCCGCCGGTAACGCTTGGCCTACACGCCGACCTCGAGTGTCCGTCGTCGTTTGCCCTGCCGCCCACGA
TAGCTAGTCGAGTCAGCAACCCGCTGCGCGCACCTGTCCGTACCGTTGGCACGCGTGCGCGAGGCAACTGGTTGCCAAACCCGGGCCATACTGGGACTCG
ATGCTGGCCCGGGTGGTGTCGGCCACCCCGGCGGTGGCTTGGTGACGATGATGGCCCGGGTTTGCAACGTCGCTGTGGGGCATACCATCGTAGTCGGCAG
GCGTCCAGGGCGCGCGGAGTGGCGAGCAAGACGAGCTACGAAGCGCAAAAAGCGGCAGCAGCTGCGAGTTTGCGCATCGAGTTTGGTGGTCGGTTTCGAG
CCGTGGAAGTCTGTGTGTGAGGAGTGCACGCATTGGTAGCGTGTGTGGTGGCGTATGTGTGCGTGGTTGTGTTTTTCCGCGTGTTTGCGTATTGTGTGCG
TAGCGCTGGATTTTGTTGTCTTTGGTTTTGTTGTTGGTTAACCCGTCAGTTTGCCCGAGTGGTCTAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACG
CGTGGGTTCAAATCCCACAGCTGACATATCCTTTTGCTGCAAACCGCAAGCCAACGCTGCAACGCCA