Description :
From Genome Similarity Track
Location :
contig_7:930532- 939873
Transcript NameFunction/comments
g2681.t1hypothetical protein
g2682.t1hypothetical protein
g2683.t1POM59681.1 CAMK protein Kinase [Phytophthora palmivora var. palmivora
g2684.t1hypothetical protein

Sequence
9341 bases(100 bases per row)
GGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGAACGAACTCCTTCTCTTGATAA
GAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGT
CAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGAT
GACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCG
CATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCTTTAGTTTTTTGATTGCCCGTGCGATACAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTG
CTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGA
GAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCT
TCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGA
CGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAGGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAG
ATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGA
TCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCG
TAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGTGTG
GCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCA
ACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATG
CGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTT
GGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTTATT
TACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCAAGATAAATGAACCAAACGAAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAA
ATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGG
TGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTGTGCCTTAGTGCATGTTGCACTAAGGTAGGA
GGTGAACCGAATGTGTAGCCCCGCTACAAATTGCCTGTGGCTCTACCTGCATCAAGCCTCCCACTCGCTTGGCCGCCTCGGGCGCAACAAGTCTCCGGTA
GCAACCTCACTGACACCTCTCGCCTTGTGCGTCCCACATCATCAGTGAACGCAACAATGTACTCTGTGTCGCCATGTGTTGGAAAGCCCCCCTCACTTAT
TATCTCTCCTTTTTTATTCGTCTCATCTTCTCCTCCACCGATCCAGTGCAGGTGAAGGTCAGTCCTTCCACCGACCACCGCGTTCTCACTTCGTTGCTGC
GCTTGATCTCCTTCCGCAGTTCCTGGACTGCCTGAGGGTTGTAGTTTCCTCCCGCCTGTGGGCCTGCAAATAAATAAGCCGTCCATGGGCTGGGATAGTC
ACTTCCTCCTCGCAGGTAGAGCGGTCACACGCTGGGACTGGGCCACGGTCTCTTGAAGGCTGCAATATCAAGACGAGGGTGTCAATTTTCTCTTCAAGAG
CTTTCATCGAGGTTTCGACAGTCTTCAGACGCTTTTGAATTGAGCTGTCGGATGATGCCTTGAAAGGACAGCAGCGTTTCGTATCCGCCCCATATACGTC
GTTGGATACCCTGAATGGACTTCACAATCTGGTGATGAACTTTGAATCACATTCTGATTGACGTATATTGACGAAATATGTCGATGTGACTGGCCCTGCA
ATCCGGTTTTGCATATTTTATTGAATCAGACAAAGGGAAGTTGCTTCCGACACCGTTTCAATACAAACCTCAAGTAGGTCGGAAGCATCTTCAAATTTCT
ATGGTTTGCAAAGCAATTTGGTCAGGGTTAGGTGAATCCTTACAAACACAAGATTCTTTTATAAACCTAACCCTTCGTTTTTGCGAATGTAAGTGCTACT
TCTTGGCACGTTAATTTCTTGAACCGCGTTGGACAAGATTCCCCGGAGGATTTGCAGCGTTGAGACGCATTCTTGTTTTTTTACATCTCATTCCATGCCA
TGTTGAAGCTAACTCGTCTTCTCCACGTTCGACATGGACCATTGCTCAGTGCAAAAGATCATTATTTGCTGTAGTAGATCGAGGAAGCAGAATTGTGAAT
TTCTGGTACGAAATGTCCCCGCCGGATCGCCACAACTCCTTCCAAGAGCGGCGTCCTCGCCGTTCTTCACCGTTCTGCTCCATGAGGCGACTGAACAATG
TTGGTTATTGAAAAGGCAGCGCATTCGGCTTATTTTTTTTATATTCAGAGTTGGTTTCGCGCTGTTTTAAAGTAGAAAACCCCGTTGGAAGCCGATCTCA
CTGGTGATAGCTGCCTTTCTTTTAAATGAGTGCGTCATTTATACTTGCAGTGTTCATTTACGTTTTGGTTAGTGATGTGTCCCGAATTCCGACAGTACCA
GTAACGTTAGCAGGATTCTGTTACCCAGCCTACGCCCAAAAACCATTTACTAGGGCTTAACCCTATAAAACCGAACTATACGTGGCCATGGTTGGACCTG
GGCTTACGTCCGCGAGCAGTGCGTATTTCGCAGGCATTCTTTCAGCTTGAGCGCGGAAGTTGCCTTCACCCCCTCCTTTTGGATCGTTTATCAGAGTATT
CTGGTGCCTTCGCTTTATCGCCTAATTCAACAGGACAAACTATTGATATTCGGTTTTCACAATAACTGGTGTTGGTTCAGTGAATACGACTACAAGTTCT
GGTGGTTGACGATCGCTGCCATGACTTTTTGAGTCCAGTCGGCGAGTTCTTGGTGCGAGTGGGCCAGTCTCTCGAGTTGCTGGGATCGGATCTCCAGCAG
CCGCAGGATCTCGTCCTGCCTCGGGAATTCTTCGTCTTCAGCTGGTGGAGAAGACGCGCTTTGTGACGTCGAGGAGATCGTCTGTGGGGACAACGAAACT
GGTTCAGGAGACAGCGGGGCTTCAACCTGCGGAGACGCTGGAGGAGACGAAGATGCCTCCGTCGTCTTTCTCCTCTTAGGAGACGTCTCGCCCCCCACCT
TCTCTGCGTCTTGCACCATGGCCTCCTCCGCTGCTCTATTGAGAGTGCTCCTAGCTGATTGTGACGTCGCCACCGTCGTGCTCTGGCTGAAACACTCGGC
CATCATCAGGTGCAGCTGCGCCGCGCTGCTGTCCTGCCACTGCTTGCGCAGCTTCGTGAGCTGGTCGCTGCACGTGACGGCGTCCGCCTGCAGGCCCAGA
GATTCGTTCTCGTTGATCGCAGTCGCCACGATGCCCCAAGCCTCGTGCACGTCCGCCACCGTCTGTGCCTCGTCGAACAGCCCGCGCAGCTTCCGGAAGC
GCAGCCGCAGCAGCTCCCGACTCGCGCCCGCGCTCCACACCGCCTCCTGCCGCAAGCGCTTCGCCGGGCGGTGGATATTCGCCGCGTCGTCCTTCGCCAT
GAGCGCTCTTCAGATGGTCCACCTGAATTTTGGACCAATATCCACCGTTACAGTCACAACGTTCCGCCCTTAACCAACTACTGGAACACCTCTCACTTCC
AGCACCTCTATAATCGTATCTTCGCAAAATCACAGTCAACGCCCTTTCTTCTTGTCAGATATGATCCCCTTGCATTATCGCTATGGTCCGCCCTACACAT
ATTTACCTAGCAGCACTGTATCCCGAACATGTCGCTATATCCGAGCTATCATTATCGTTTCCGCCACCAATAGCGCAACCGCTGAAAATGGACCGGTCGC
AGTGGAAGCGCGTGGATGTCGTCGTGCCCGCTGGCCCGCTGGGACTCATCGTGAGCAAGGCCCCCTCAGGCGAGGGCCACGTGATCGTGGATGGCTTCCG
CCCTGTGGGCGCGGGCGCGGCCGGCGCGCTGGAGCAGCAGGGCGAGGTGCGATCTCAGTCGCTGCTGCTGGGCGTCAATGCGCACGACTTCACGGACGCG
GCGGCCGCCTGGAGCTTCGAGAAGATCCGCGAGATCCTCGTGAGCACCAGCGGTGCCGAGCGCGTCGTGCGCTTCCTCGTGCCCCCGCCGCCGGCCGTGC
AGTTCGGCGAGCTGGCGGTACACGACGCCGCGCGCCGCTTCGCCGACGACTACGCGCTGGGCCGAGAGCTCGGCTCGGGCACGTTCTCAGTGGTTAGGGA
GGCCACGCACAAGACGACGGGCGAGCGCTTCGCCATCAAGTGCATCAAGCGCGCGCAGCTGTCGACCGACGACCTGCGCGCGCTCGTGGCCGAGGTGAAG
ATCCTGCGGGAGATGCAGCACCCGCACATTGTCAAACTCTACGACGTGTTCCAGGAGGAGAAGTACTTTTTCCTAGTGACCGAGTACATGCCTGGAGGGG
AGCTCTTTGAAAGGATCGTCAAGAAGAACTTTTACTCGGAGAGAGAGGCCAGAGACCTCGTCAAGGTGCTACTGGAGACCATTGCCTTCTGTCATAACGC
TGATGTGGTGCACAGAGATCTCAAGCCCGAGAACCTGCTGTTGAGCAGCGCCGAGGACGACGCTGACATCAAACTGGCCGACTTTGGGTTCGCCAAGAAA
TCGGCCATCCAGAACGGAGACGCAGGACTCGTCACGGCCTGTGGCACGCCCGGGTATGTGGCGCCCGAGATCTTGATGTCCAAGCCGTACGGGAAGGAGG
TGGACATCTGGAGCATCGGCGTCATCACGTACATTTTGCTCTGCGGGTACCCGCCCTTCCACCACGACAACCAGGGCGTGCTCTTCCGACTCATCAAGGC
CGGACGCTACGAGTTCGACTCGCCCTACTGGGACGACGTCTCGACGGAGGCCAAAGACCTCATCAACAAGATGCTCGTGCTCAAGCCTGCGGACCGCTGG
TCGGCGCGGCAGCTGTTGGAGCACCCGTGGATCGCTGGAGACGCAGTCAAGGACGTGCAGCTCACCACGGCGTTGCAGGAGCTGCGCAAGTTTAACGCGC
GTCGGAAATTCCGTGCTGCGGTTAGCACCGTCAAGGCCACGATTTCGCTCACGAAAGCGCTAACGCTCGGCAGCAGCCCGCGCAGCAACAAGGACAGCGG
CGATGAAGGCGACAAGGACGCTCTGAGTGCACCTGCAGTTGCCGCGGCAAATGTTTCAGCTGTGCCGCCCCCAGCGCCCACAGCTACTCAGTAGATAGGA
CCCAGAGATCGTTTCACATTTTCGTGGAGAGCAGCACGTAGCAGGTAGCAGCTATGGACAGCTGCGATGTGCTAGAGCTCGCGCTGTTCTCGCGTGTGGG
GCAGTCGAATACATACTACTTCAAGACTTGAAGACACAGTCCAACCGCCATTGCTGCGGTAAGAAAACAATGAGCAGGAAAATGAAAGTCACTTGGTCGC
GATGAGAGTGTGCGTTTCACGGATGAACGTTGAAGTGGAGCTCCTGGAAATAGTGCGGATCGGACTGAGGACGAGACAAGGTAAGGTGCTGGTCATGTTC
GAGGACAGCACGGTCTGAAAGTGGCGTGTGAAGCTATTGAGCTAGGTTCACCGGGAGCCTTTCAGCACTTCCAACCCATTTGCCTGTGGACTTTGCTTCT
TCGATCTCATTGTGTGATTTTCCAGCTAGGTGGCAAGCGATCGAGGGTACAAGGCATTCGTCCTTACCATGTTGGCGTTGTTTTCGGCGGTCAAACCTGC
AACTTCAGGCAATCAACACTTAATCTCGACGCCTGGCAGTCCGACCGGGGAATTCAAAGAGATGTCGAACGGTTTAGTCAAACCCTCCAGCATCGTTATT
GCTGGCATGGACATCACGTCGTGGCCGGTTGTCGAGGTCAGCGTTCCTGCTGGTCCACTCGGAATTTTGCTCGACGGAAGCTGCACCGATGCAGCTTTGC
TTGACGATTTTGCTCCCGTAGCTCGAGAAGGCACGCCTGGCGCCGTGGAAGGAGTGGTAAGGTCCCTCATGGTAGCGTTCTAGTCGGAATGGACAAGTTC
GACTTCGTGGAGCAACCGCGGAAAACTCTTGCTGAAGTCGGCGCCATTCTGCGAGAAGCTGCTCACCTCAAGCGTCAGCTACGATTTCGAGTGCCACCGC
AGAACTACCAGAAGCCAGATCCAGCAGCTCATGAGAACGACAAGTCAAAGCTGTTAACGGGTGCACCAAGTAGCTCAGCGAGCGTTGTGGGGGGCAATGA
GACTGGCAAACCTACTGGTGAATGGTCTAGCTGGATGAGGGGTGGTCTACGAGCTGCAACCACAATTGCTGCTCCAGCGTCTCGTGTAGCACCCCCAAAG
CAACAGGTACCACCAGCTTCGCAGCCAACACAAGAGCCGACAGCGCCGTCACTAGCTGTGCCTCCAGCATTGAAGCCAACAGGTAAACCAGCTTCGTTTG
TGCGCGTGACAGGCTTAGAGGACCGCACACTGAAAGCAGACAAACATCCATTTGTGCCAACCGCGCACGATAAGGTGGTGAGCGTAGAGGTACCACCAGG
TTCACTCGGTCTGCACCTTGACGGCAGCGTTGTAAATCGTGCTGTGGTGCTGGGCTTCATGCCGCTCGCCGATGGCTCTCGCGGCGCACTCGAACGAAGT
GGCAGCTTGGCTTCTGGTGCTGAAATTGTGGAGATTAACGGAGAAGACGTCTCGCAGGAATCTCTAGCTGGAATTCGTGAGCGGTTGGGTCGTAGCAGTG
GTGAACCGCGTCGCCTTAGCTTCCGACTGCCACCTCCGATCAAGCTGGTGGTTCCATTGGTGCCAGACGGTTCCTCGTCGGTAGCAAGTTCGTCAGTAGG
CTCGCCACCACCAGCAAGTCGGCGGGTATCCACTGCCAGCATGCAGCGCATGAACCTTCTCGCGGCTTCCCAGCCCACGTACTCGGAGGACACGGAACTG
CGCCGACGTCTCGAGCTGAAGTTGGTCATGAGCTTCGATCGCAAAGAGATCAAGTACAAAGAGTGCTGGTTTGCAGTTCATACCGAGTGGATGAATCGCT
GGGCGCTTTTTGTGGGTAAAGGAGGTCCTGAGCCAGGTCTCATAACGAACCACGAGCTATTGGAGCCTGGGTATGCGTCTGGTGAAGACCCGAACCGGGC
TGCTTTTGTTCGGCCAGGGCTTGCGATCACTAAGGACTTCCGCCTTGTGACTCCAATGGTCTGGAGTTTGCTCGTGGCTCTGCATGGAGCAGACAATGCT
CCTCCGATTGCAAGGTTTGGACTAAACATCTACTCAGAAGCACCTGAAGATATTAACGAGATACTGCATGACGCCAAGCCTCAAGCTGTTGGTCTTGCAA
CCAGTCTTCGCGAGAAGTGCCAAGTCGAGAACAAGTGAACTACTCGCTATATAAACACCACCCCAGCAAAATCAATACTTTAAGTAAATACTTCGAAGTG
CATTACAAGCGCTTTCGCGTTATCAATGTCTTGATCTTCTTCGCTCGCGCACCGATATAGTCGCCACGGGTGCAGGCTCCGAAAATGTCACGTAGGGACT
GAAGTACTCCACCTGCCGGCGGATGAAAAGCAGTTGATCTGGACTTCCAGTGGCGAGTTCCACCATAACCGAGGAAACCAGCCCAGGATCGTCACTGTGC
GCTGCACTGCAAGTATCGAGGTGAAGACGTCGAATCCCGCGCTGTTTACCACACGCACACTCCAAAGCAGGCGAGACGCAAAAACCTCACCGTTGCCGAT
AATAATCTCTAAAGCACAACCTGCCGCGACGGAGAGTACGACAATGACTGCAGGTAGACCGAAATGCTTTCGAATGTTGACTTGGCACGCGAAAATCGGT
GTGATCGCATCAAGTACCAGCAGACAATGAAACCAGAGCCACCATGCGACGACGGCGAGGCTGGACGAAGCTTGCCACTGCAGTAGATCCAAAAGACAGA
TTGCGAGCGCAGTACCTTGGAAAGTCGAAAAGAGCACATCGAAATTCCAGACGAGCAGTCGAAGCAGGTCTCGTTGGGCGACTGCGGCGCACACAGCCAC
GAACATGACAGAGGATAGAGCTGCTAGCACTGCAATCCCCGTTTTGAGCCCGTTAATCCGCTCGCTTTGGTAGTGCAGAAGCGTTATTATCCAGGAAATT
GCGGTGGCGCCGATGCCTACTGCACCCACACAATACAGGGCTGTTAAAGTGTGTCGAGATGAAAATTTGTGAACAAGATGGCCGGGTAGTAGCGTGTTTC
TTGCGTCTACGACATGCGCTTTGGCTGGAGCAAGCTGCAACTGCTGTACTCGAGACGATTTTGCTGAATTAAACAGCCCAGATCTTGCTTCAGTTGCACA
GTTGTTGCTCAGAGTGTCCGATTCGGCGCCGCGTAGGCCAAGTCGTACCCGCGCCAGTATCAAAACGCAAGGAATAGTGTGTCGGCCCTGTGTTGGGCTT
GGATTATTTTTCCGATCATGCTCGCGAATGCGTATGCGTCGCCGCTTTATGTAGGCCTTCTTGAACATGAAAATGGCAAGTGTTGACGCGGTGAAAACCA
CAACCTGGCGCGATGGGAATGGCATAGCCCCGATGTACAAT