Description :
From Genome Similarity Track
Location :
contig_7:930508- 939849
Transcript NameFunction/comments
g2527.t1hypothetical protein
g2528.t1hypothetical protein
g2529.t1POM59681.1 CAMK protein Kinase [Phytophthora palmivora var. palmivora

Sequence
9341 bases(100 bases per row)
CGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAG
CTCGTCGAACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAG
ACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGAC
TTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTCATTGC
AGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCTTTAGTTTTTTGATTGCCCGTGCGATACAGTATCGCC
ACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGC
TGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACAT
GCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGG
CCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAGGTACCGTGCTCTTTGGGCGTAA
GCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGA
AATCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTT
CGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGCTTACG
TGGAGTTTCAATGACTCCACGCGCGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACC
GTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGAC
AGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGT
ATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCG
CACGTGTAGGAGGAAGCGTAGGAGTTATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCAAGATAAATGAACCAAACGAAAGCTTTG
GTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTAT
CTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTGT
GCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACAAATTGCCTGTGGCTCTACCTGCATCAAGCCTCCCACTCGCTTG
GCCGCCTCGGGCGCAACAAGTCTCCGGTAGCAACCTCACTGACACCTCTCGCCTTGTGCGTCCCACATCATCAGTGAACGCAACAATGTACTCTGTGTCG
CCATGTGTTGGAAAGCCCCCCTCACTTATTATCTCTCCTTTTTTATTCGTCTCATCTTCTCCTCCACCGATCCAGTGCAGGTGAAGGTCAGTCCTTCCAC
CGACCACCGCGTTCTCACTTCGTTGCTGCGCTTGATCTCCTTCCGCAGTTCCTGGACTGCCTGAGGGTTGTAGTTTCCTCCCGCCTGTGGGCCTGCAAAT
AAATAAGCCGTCCATGGGCTGGGATAGTCACTTCCTCCTCGCAGGTAGAGCGGTCACACGCTGGGACTGGGCCACGGTCTCTTGAAGGCTGCAATATCAA
GACGAGGGTGTCAATTTTCTCTTCAAGAGCTTTCATCGAGGTTTCGACAGTCTTCAGACGCTTTTGAATTGAGCTGTCGGATGATGCCTTGAAAGGACAG
CAGCGTTTCGTATCCGCCCCATATACGTCGTTGGATACCCTGAATGGACTTCACAATCTGGTGATGAACTTTGAATCACATTCTGATTGACGTATATTGA
CGAAATATGTCGATGTGACTGGCCCTGCAATCCGGTTTTGCATATTTTATTGAATCAGACAAAGGGAAGTTGCTTCCGACACCGTTTCAATACAAACCTC
AAGTAGGTCGGAAGCATCTTCAAATTTCTATGGTTTGCAAAGCAATTTGGTCAGGGTTAGGTGAATCCTTACAAACACAAGATTCTTTTATAAACCTAAC
CCTTCGTTTTTGCGAATGTAAGTGCTACTTCTTGGCACGTTAATTTCTTGAACCGCGTTGGACAAGATTCCCCGGAGGATTTGCAGCGTTGAGACGCATT
CTTGTTTTTTTACATCTCATTCCATGCCATGTTGAAGCTAACTCGTCTTCTCCACGTTCGACATGGACCATTGCTCAGTGCAAAAGATCATTATTTGCTG
TAGTAGATCGAGGAAGCAGAATTGTGAATTTCTGGTACGAAATGTCCCCGCCGGATCGCCACAACTCCTTCCAAGAGCGGCGTCCTCGCCGTTCTTCACC
GTTCTGCTCCATGAGGCGACTGAACAATGTTGGTTATTGAAAAGGCAGCGCATTCGGCTTATTTTTTTTATATTCAGAGTTGGTTTCGCGCTGTTTTAAA
GTAGAAAACCCCGTTGGAAGCCGATCTCACTGGTGATAGCTGCCTTTCTTTTAAATGAGTGCGTCATTTATACTTGCAGTGTTCATTTACGTTTTGGTTA
GTGATGTGTCCCGAATTCCGACAGTACCAGTAACGTTAGCAGGATTCTGTTACCCAGCCTACGCCCAAAAACCATTTACTAGGGCTTAACCCTATAAAAC
CGAACTATACGTGGCCATGGTTGGACCTGGACTTACGTCCGCGAGCAGTGCGTATTTCGCAGGCATTCTTTCAGCTTGAGCGCGGAAGTTGCCTTCACCC
CCTCCTTTTGGATCGTTTATCAGAGTATTCTGGTGCCTTCGCTTTATCGCCTAATTCAACAGGACAAACTATTGATATTCGGTTTTCACAATAACTGGTG
TTGGTTCAGTGAATACGACTACAAGTTCTGGTGGTTGACGATCGCTGCCATGACTTTTTGAGTCCAGTCGGCGAGTTCTTGGTGCGAGTGGGCCAGTCTC
TCGAGTTGCTGGGATCGGATCTCCAGCAGCCGCAGGATCTCGTCCTGCCTCGGGAATTCTTCGTCTTCAGCTGGTGGAGAAGACGCGCTTTGTGACGTCG
AGGAGATCGTCTGTGGGGACAACGAAACTGGTTCAGGAGACAGCGGGGCTTCAACCTGCGGAGACGCTGGAGGAGACGAAGATGCCTCCGTCGTCTTTCT
CCTCTTAGGAGACGTCTCGCCCCCCACCTTCTCTGCGTCTTGCACCATGGCCTCCTCCGCTGCTCTATTGAGAGTGCTCCTAGCTGATTGTGACGTCGCC
ACCGTCGTGCTCTGGCTGAAACACTCGGCCATCATCAGGTGCAGCTGCGCCGCGCTGCTGTCCTGCCACTGCTTGCGCAGCTTCGTGAGCTGGTCGCTGC
ACGTGACGGCGTCCGCCTGCAGGCCCAGAGATTCGTTCTCGTTGATCGCAGTCGCCACGATGCCCCAAGCCTCGTGCACGTCCGCCACCGTCTGTGCCTC
GTCGAACAGCCCGCGCAGCTTCCGGAAGCGCAGCCGCAGCAGCTCCCGACTCGCGCCCGCGCTCCACACCGCCTCCTGCCGCAAGCGCTTCGCCGGGCGG
TGGATATTCGCCGCGTCGTCCTTCGCCATGAGCGCTCTTCAGATGGTCCACCTGAATTTTGGACCAATATCCACCGTTACAGTCACAACGTTCCGCCCTT
AACCAACTACTGGAACACCTCTCACTTCCAGCACCTCTATAATCGTATCTTCGCAAAATCACAGTCAACGCCCTTTCTTCTTGTCAGATATGATCCCCTT
GCATTATCGCTATGGTCCGCCCTACACATATTTACCTAGCAGCACTGTATCCCGAACATGTCGCTCCATCCGAGCTATCATTATCGTTTCCGCCACCAAT
AGCGCAACCGCTGAAAATGGACCGGTCGCAGTGGAAGCGCGTGGATGTCGTCGTGCCCGCTGGCCCGCTGGGACTCATCGTGAGCAAGGCCCCCTCAGGC
GAGGGCCACGTGATCGTGGATGGCTTCCGCCCTGTGGGCGCGGGCGCGGCCGGCGCGCTGGAGCAGCAGGGCGAGGTGCGATCTCAGTCGCTGCTGCTGG
GCGTCAATGCGCACGACTTCACGGACGCGGCGGCCGCCTGGAGCTTCGAGAAGATCCGCGAGATCCTCGTGAGCACCAGCGGTGCCGAGCGCGTCGTGCG
CTTCCTCGTGCCCCCGCCGCCGGCCGTGCAGTTCGGCGAGCTGGCGGTACACGACGCCGCGCGCCGCTTCGCCGACGACTACGCGCTGGGCCGAGAGCTC
GGCTCGGGCACGTTCTCAGTGGTTAGGGAGGCCACGCACAAGACGACGGGCGAGCGCTTCGCCATCAAGTGCATCAAGCGCGCGCAGCTGTCGACCGACG
ACCTGCGCGCGCTCGTGGCCGAGGTGAAGATCCTGCGGGAGATGCAGCACCCGCACATTGTCAAACTCTACGACGTGTTCCAGGAGGAGAAGTACTTTTT
CCTAGTGACCGAGTACATGCCTGGAGGGGAGCTCTTTGAAAGGATCGTCAAGAAGAACTTTTACTCGGAGAGAGAGGCCAGAGACCTCGTCAAGGTGCTA
CTGGAGACCATTGCCTTCTGTCATAACGCTGATGTGGTGCACAGAGATCTCAAGCCCGAGAACCTGCTGTTGAGCAGCGCCGAGGACGACGCTGACATCA
AACTGGCCGACTTTGGGTTCGCCAAGAAATCGGCCATCCAGAACGGAGACGCAGGACTCGTCACGGCCTGTGGCACGCCCGGGTATGTGGCGCCCGAGAT
CTTGATGTCCAAGCCGTACGGGAAGGAGGTGGACATCTGGAGCATCGGCGTCATCACGTACATTTTGCTCTGCGGGTACCCGCCCTTCCACCACGACAAC
CAGGGCGTGCTCTTCCGACTCATCAAGGCCGGACGCTACGAGTTCGACTCGCCCTACTGGGACGACGTCTCGACGGAGGCCAAAGACCTCATCAACAAGA
TGCTCGTGCTCAAGCCTGCGGACCGCTGGTCGGCGCGGCAGCTGTTGGAGCACCCGTGGATCGCTGGAGACGCAGTCAAGGACGTGCAGCTCACCACGGC
GTTGCAGGAGCTGCGCAAGTTTAACGCGCGTCGGAAATTCCGTGCTGCGGTTAGCACCGTCAAGGCCACGATTTCGCTCACGAAAGCGCTAACGCTCGGC
AGCAGCCCGCGCAGCAACAAGGACAGCGGCGATGAAGGCGACAAGGACGCTCTGAGTGCACCTGCAGTTGCCGCGGCAAATGTTTCAGCTGTGCCGCCCC
CAGCGCCCACAGCTACTCAGTAGATAGGACCCAGAGATCGTTTCACATTTTCGTGGAGAGCAGCACGTAGCAGGTAGCAGCTATGGACAGCTGCGATGTG
CTAGAGCTCGCGCTGTTCTCGCGTGTGGGGCAGTCGAATACATACTACTTCAAGACTTGAAGACACAGTCCAACCGCCATTGCTGCGGTAAGAAAACAAT
GAGCAGGAAAATGAAAGTCACTTGGTCGCGATGAGAGTGTGCGTTTCACGGATGAACGTTGAAGTGGAGCTCCTGGAAATAGTGCGGATCGGACTGAGGA
CGAGACAAGGTAAGGTGCTGGTCATGTTCGAGGACAGCACGGTCTGAAAGTGGCGTGTGAAGCTATTGAGCTAGGTTCACCGGGAGCCTTTCAGCACTTC
CAACCCATTTGCCTGTGGACTTTGCTTCTTCGATCTCATTGTGTGATTTTCCAGCTAGGTGGCAAGCGATCGAGGGTACAAGGCATTCGTCCTTACCATG
TTGGCGTTGTTTTCGGCGGTCAAACCTGCAACTTCAGGCAATCAACACTTAATCTCGACGCCTGGCAGTCCGACCGGGGAATTCAAAGAGATGTCGAACG
GTTTAGTCAAACCCTCCAGCATCGTTATTGCTGGCATGGACATCACGTCGTGGCCGGTTGTCGAGGTCAGCGTTCCTGCTGGTCCACTCGGAATTTTGCT
CGACGGAAGCTGCACCGATGCAGCTTTGCTTGACGATTTTGCTCCCGTAGCTCGAGAAGGCACGCCTGGCGCCGTGGAAGGAGTGGTAAGGTCCCTCATG
GTAGCGTTCTAGTCGGAATGGACAAGTTCGACTTCGTGGAGCAACCGCGGAAAACTCTTGCTGAAGTCGGCGCCATTCTGCGAGAAGCTGCTCACCTCAA
GCGTCAGCTACGATTTCGAGTGCCACCGCAGAACTACCAGAAGCCAGATCCAGCAGCTCATGAGAACGACAAGTCAAAGCTGTTAACGGGTGCACCAAGT
AGCTCAGCGAGCGTTGTGGGGGGCAATGAGACTGGCAAACCTACTGGTGAATGGTCTAGCTGGATGAGGGGTGGTCTACGAGCTGCAACCACAATTGCTG
CTCCAGCGTCTCGTGTAGCACCCCCAAAGCAACAGGTACCACCAGCTTCGCAGCCAACACAAGAGCCGACAGCGCCGTCACTAGCTGTGCCTCCAGCATT
GAAGCCAACAGGTAAACCAGCTTCGTTTGTGCGCGTGACAGGCTTAGAGGACCGCACACTGAAAGCAGACAAACATCCATTTGTGCCAACCGCGCACGAT
AAGGTGGTGAGCATAGAGGTACCACGAGGTTCACTCGGTCTGCACCTTGACGGCAGCGTTGTAAATCGTGCTGTGGTGCTGGGCTTCATGTCGCTCGCCG
ATGGCTCTCGCGGCGCACTCGAACGAAGTGGCAGCTTGGCTTCTGGTGCTGAAATTGTGGAGATTAACGGAGAAGACGTCTCGCAGGAATCTCTAGCTGG
AATTCGTGAGCGGTTGGGTCGTAGCAGTGGTGAACCGCGTCGCCTTAGCTTCCGACTGCCACCTCCGATCAAGCTGGTGGTTCCATTGGTGCCAGACGGT
TCCTCGTCGGTAGCAAGTTCGTCAGTAGGCTCGCCACCACCAGCAAGTCGGCGGGTATCCACTGCCAGCATGCAGCGCATGAACCTTCTCGCGGCTTCCC
AGCCCACGTACTCAGAGGACACGGAACTGCGCCGACGTCTCGAGCTGAAGTTGGTCATGAGCTTCGATCGCAAAGAGATCAAGTACAAAGAGTGCTGGTT
TGCAGTTCATACCGAGTGGATGAATCGCTGGGCGCTTTTTGTGGGTAAAGGAGGTCCTGAGCCAGGTCTCATAACGAACCACGAGCTATTGGAGCCTGGG
TATGCGTCTGGTGAAGACCCGAACCGGGCTGCTTTTGTTCGGCCAGGGCTTGCGATCACTAAGGACTTCCGCCTTGTGACTCCAATGGTCTGGAGTTTGC
TCGTGGCTCTGCATGGAGCAGACAATGCTCCTCCGATTGCAAGGTTTGGACTAAACATCTACTCAGAAGCACCTGAAGATATTAACGAGATACTGCATGA
CGCCAAGCCTCAAGCTGTTGGTCTTGCAACCAGTCTTCGCGAGAAGTGCCAAGTCGAGAACAAGTGAACTACTCGCTATATAAACACCACCCCAGCAAAA
TCAATACTTTAAGTAAATACTTCGAAGTGCATTACAAGCGCTTTCGCGTTATCAATGTCTTGATCTTCTTCGCTCGCGCACCGATATAGTCGCCACGGGT
GCAGGCTCCGAAAATGTCACGTAGGGACTGAAGTACTCCACCTGCCGGCGGATGAAAAGCAGTTGATCTGGACTTCCAGTGGCGAGTTCCACCATAACCG
AGGAAACCAGCCCAGGATCGTCACTGTGCGCTGCACTGCAAGTATCGAGGTGAAGACGTCGAATCCCGCGCTGTTTACCACACGCACACTCCAAAGCAGG
CGAGACGCAAAAACCTCACCGTTGCCGATAATAAGCTCTAAAGCACAACCTGCCGCAACGGAGAGTACGACAATGACTGCAGGTAGACCGAAATGCTTTC
GAATGTTGACTTGGCACGCGAAAATCGGTGTGATCGCATCAAGTACCAGCAGACAATGAAACCAGAGCCACCATGCGACGACGGCGAGGCTGGACGAAGC
TTGCCACTGCAGTAGATCCAAAAGACAGATTGCGAGCGCAGTACCTTGGAAAGTCGAAAAGAGCACATCGAAATTCCAGACGAGCAGTCGAAGCAGGTCT
CGTTGGGCGACTGCGGCGCACACAGCCACGAACATGACAGAGGATAGAGCTGCTAGCACTGCAATCCCCGTTTTGAGCCCGTTAATCCGCTCGCTTTGGT
AGTGCAGAAGCGTTATTATCCAGGAAATTGCGGTGGCGCCGATGCCTACTGCACCCACACAATACAGGGCTGTTAAAGTGTGTCGAGATGAAAATTTGTG
AACAAGATGGCCGGGTAGTAGCGTGTTTCTTGCGTCTACGACATGCGCTTTGGCTGGAGCAAGCTGCAACTGCTGTACTCGAGACGATTTTGCTGAATTA
AACAGCCCAGATCTTGCTTCAGTTGCACAGTTGTTGCTCAGAGTGTCCGATTCGGCGCCGCGTAGGCCAAGTCGTACCCGCGCCAGTATCAAAACGCAAG
GAATAGTGTGTCGGCCCTGTGTTGGGCTTGGATTATTTTTCCGATCATGCTCGCGAATGCGTATGCGTCGCCGCTTTATGTAGGCCTTCTTGAACATGAA
AATGGCAAGTGTTGACGCGGTGAAAACCACAATCTGGCGCG