Description :
From Genome Similarity Track
Location :
contig_164:9303- 10940
Transcript NameFunction/comments
g14503.t1hypothetical protein

Sequence
1637 bases(100 bases per row)
ATTCACACGAAGTCGTTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCACTCTGGATACTCGAC
CAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGTTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGC
ACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCAT
CGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCG
CAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCTCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCA
CTGATGTTCAGGGAGTTGAGTACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCAGTCA
TGCGATCCGCTACGGCTTCGTTGATATGATGGATTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTATTCGTCCGTTGCGACTTCCGAATT
GTTGATCTCGGAGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATTGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGACGGGGTTG
TTGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTTTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACG
CAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAGTGGCCACAGTCCGGAAGACTTC
AGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTT
CTGCCTCATTATCCAAAACATCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCATCCCAAACTATCAAACTTGCTTT
CCTCATCAATTCCGTGACCTGAGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAAGGGATTTTGAAGGTAGAATGCGCTGTCCGACCT
CCCATAAGCCGTAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGACCAGTATGTTCCGAAGCAGTGTCGATT
TCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGTTCAAGCACTACTCCTC
ATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGC
ACCAGGCGAGGGTACTCGCTCAGCTGAGGGAGATTGT