Description :
From Genome Similarity Track
Location :
contig_20:9303- 10402
Sequence
1099 bases(100 bases per row)
ATACCAGGTTGATTAAATGTCAAAGTAACATACTGCAAGTTACATTAAAAAAGACGGCTATCGGCTCTATGTCGGTGCGGAAGTGCTGGATTATCCAAGC
CCATCACGGGATGCAACGTTTCGCCTCCAAAGTAAGACAAGCGGAATAAAAACCAAGTCTGGATTCTGTCAAGCGCTGTACAATGATTCATTGGTTGTTG
TAGCAAAGAAGACGTTGTCAAAAGCTTTATGTTGGTACGATAGTACCTTCCTTACACGGAACGTTATCACTACTTCCCAGAAACACATCACGATCTATCA
CAACTACTTACAAACGATCTGTTTGGTGGATAAACAGCTCTCCTCAATTCATTTTCTTACTTTGACTGACGGTTGTCCGACATCGATAGGCGAGGTTCCA
CCTACTTCACCACCCTTAGCACCGTAATGCCAGTCGCTTGTACAGCGAGTAGCTCTCCCACTCGTCAAGCAGCAGCTCTATATCCACGAATTTGCCGAAC
CGGGCTTGTTGGATTCATGAAGCGTTGCTGTGCGTGTGGTGCTGCGAGATCGCCAAGGCCTCCTGTACATCAACATCTCAAGCCCTTCGTACAGTTGCTA
TGTGCTGTAGCTCTTGTCGAAGCTCCTGAGTTTCCACTCGTGCCCATTCTTGTATTTCGTTTCTTGCCACATCAGCTACTCGGGCTGATATCTTTTGGGG
GTTCGCTTTCCGAACCTTGACCATAGGGAGGTGCCCACGAGTCGGAGCTCGAAGGCAGTCTACCAATCGGGTGCACAAGCGGGTCTAAAAGGGTTGGTTC
CACACGAAGTCGGCAAGCTGACAAATGTGGTGGCACCTTAATTAACACAAAGTTAATGAACGAGACGTACTATCTAACTTCTTGGGTCCAATAACCCGAC
AAGTGGTAGCAATCCATCCTCCATTTGACCATGCTTCCGAAGCGATATGAGGTTTAGGCGTTCCACCACTAAGTAGGATTCCCATACATGTGGCATTCAT
GTTGTTCTTGAAGACGGGATATTTCCTTCCACAGACGAATACCGAATCCATGACCGATCGAGACGTAATTGAATAGCGCTTTTTGATGGCGACAGATAC