Description :
From Genome Similarity Track
Location :
Scaffold_139:93025- 103351
Transcript NameFunction/comments
Phyin_T30-4PITG_20374Putative uncharacterized protein
Phyin_T30-4PITG_20375Voltage-gated Ion Channel (VIC) Superfamily

Sequence
10326 bases(100 bases per row)
ACAAAGACACGAAGCTGTGCTTCCGTCGATCTCGCCCCTAGTTGCCGCAGTTTCCTCCCTTCCCTGGCCGCATCTGCTCATGGATGAACCCCGCAGCATT
CGCGGATTTCTAGGAAGGCGCAAGCACCGCAAGCACAAACGATCGAACGCTAATTCCCTAGACGATCCGCACGCTGCCAGCGCCAGCGCCAGCATCACCA
GTAGCCTCACGTCCGACACCACTACCGTAAGTATGGAGGGAATGCTCAAGAAGCGCGTGGCCAAAATGCCGGTGATGCACGATCGTTACTGTGTGGCCAC
GTGGGAGCTGGACACCCACGACCGCAAGTGTGTCATGTTGCGCAGCTACAAGAGTCGGAAAACCTACGACGCGCACCCAGAGAAGCCTACGAGTGTGCAC
GAGATCAAGTGCATCAGCGACTGGGACGGGAAGACCGGATTCCACCGCTATCCACACGCTTTCACCATGGAGACACGCGATAAGAAGCTCTTTCAGTGTG
TAGCTCCGTGCGCAGCCGACAAGGACAAGTGGCTCGAGCTTATGGCCATCCAATCTGCCTTCAGCAGCTCCCGTGACATGCGTCTGGGCAGCGTTGGTAG
TCTTGTACCGCTTCGACGCACGCAGAGCGTCGAGTCTGCGGCCGACAACGGCAAACCCCGAGCCTACACTGGCGCCTCGATGGGGAAAACAAGAGCTGAG
AGCGCCGCGAACATCGAACACTCGACCGACTCGGAAGACCAGATCAACTTTCCTGGACACGACGGACTCTTCAGGACCACGTCGGAAGCATCGAGTGACT
CGTCGGAGCTGCCTAATGTCGACAAGAGCGAGCCTGCGGACTGGGGGCTGTATGGTGAGGCCACTGGCGAGACCAAGTCCAAGTATGATGTACTGGACGA
TGCTAAGCCTATTTTTCTCGATAAGGAACTGCTGGGTGCGCGTGGAGAGACCAAGACACTGGCCTCGGACCAATTCTTGTTCGAAGAGGCTGGTGCCAGT
CGATTCGGCGCTGTGGTCGTCAAGAAAGCGGCGGAAAGTGACGACGAAGACGCCGAGTTTATCGACGAGAAGTTTGCGGCACGAGAGGCCCAGAAAGAGA
ATGAGAAAAACATGAAACGCCGCGCGCAGAAGCTCGAGTCCAACCGCGACCTGTACGCTGAGATGGCGGCTGCGAGACTTCACAGCATGCGCAAAGACGC
TCGCCACCCGAAGAAGAGCCACAGTCACAGTCGCCCGTCTGCTGGTAGCGACGAGAGTGTCGATGAACCCGACGAAGACCAATCGATGGCCGACGAGGAG
GACATAGAGGAAGCGATCGAGCTGGAGGAAATGCACCAGCGTCGTAGCAGTCGCAACCATCGCAGCTCCAAGCGACCTGTTGAGGCAGACGGAGAGGAAG
CGATCCAGCTGGAGGAAATGCACCAGCGTCACAGCAACAGTAGCCGTCGCAGCTCCAGGCGAGCTGTTGGTGCAGAAGAAGAGGAAGCGATCGAGCTGGA
GGAAATGCACCAGCGCCACAGTAGCCGCAGCCGCCGCAGCTCCAAGAGCCACAGGAAGAGCTTTGTGAGTAGCAGCGAGAACACCAATAGTGTCCATGGC
GGGTATGCTAGTGGAGACGACGAAGAGGAGGACGGGGAGGACGCAGTGCCCGGTGCTGATGTTGCCCTAGAGACGACCGAAGCGGAGAGCGCAGAAGCCG
AAGAGCTACGGCTGCTGAAGAAGAGATACCGCGCCGAACATCGTGCCAAGAAACGTCTGATAAAGGAAAAGGAAGAGGAGGAACGCACTGCAATGGAGGC
GGCTGAGCTCGCCCGTGCCCATCGCGAACAGCAACGTGCTCGTGAGGAGGCAAAATCTCGAGAGGAGCAGGAGAAGCGCGACAAGAAGGAGCGTCGCGAG
ATGAAAGAGAAGCTGAAACGCGAGAAGGCGAAGCAACGACAGGCTGAAGCTGAGCTCAGGAAATTGGTGGAGCTGAAACAAGCCGAGGAGGAGAGGCGCG
AGCGAGAACGCAAGGAGAAGAAGGAAAAAAAGGAGAAGAAGAAGTCCAAGAAGAAAGAAAAGTACACGTCGCCTGCTGAGCGTATCCACAAGAAAGAGGC
GCGCGACGCCGAACGTGCGGCTGAGTCTGCTGCTGCCGTCGTGGTAGAAGCTGAGACCTCGAACGCTTTGGTCGTTGTGGAGAAGCCGGTGGAACAGCAA
TCGACACAACAGGCGCTCGCGGGACTGGAACCTGCTCTTGCACCCGCCCCAAAGGCAACTTCATCGTCCGTTCAGACCGAAACTGTACCAACAGAACAGA
CAGCACCTGCAGTACCCTTACCTGTCCCAGCTCCGGCCACCGCACCTGTTGCAAGTCCTGTTGTTGTTCCTCAAGTTGCCGCTCCTGCCAGTGCCCCTGC
ACCTGTTGCCGCTCCTGCTCCTGCTCAGGCGATGCCGATGCCGATGTATCAAATGGTCCCGCCGCCATTCGTGCCAACGTATTCTGTCGGCCCACAGAGC
ATGCCGGCGTACGGTCTTGCCGCAACCTTTGGTGCGTACCCTCCGCTATACCCTGCTCCGTACAGCTATGGAGGACCCGTGGGACCTCAATCTATGTTCA
TGCGTCCGAACATGGGCTTCGTGGCCGGACTTAGCGCCATGGGGTCGTTCGGCAAGACCACGGGTCCAGATCCCGCACCTTCCAGCCAGGATTCCATGAT
CGGCCCGCAACTCCCGACTCCGGAAGAGCGCGCTGCTGCCTCCTTAGCAGGCGCGGGCGCCCCTCCTCCCCCACCACCACCTCCGTCATCGAGCAAGGCT
AGCGGTGCCAAGCTGACAAACTTGCCGGAATTGCCTGATGTGATCGAGTTTTAGGAGAGATGTTGCCTGAGTTGCTTAAGTTAATGCAAAACCCTTTTTT
GCCATTTTATTTCAAGCTCGTTGACTCATTTTGTCGTGGTGGTTTCGTGCACGCTAGCTCCTTTCAGCCATGCGCGTGATGCCGGCTCCGGCGGCGTCGC
GGCGATCCAGTCGCAGCCGCCGGCGCTCGTCAGTAACACGAACGCCAAGTCGGTTGACATCGCTTTTGCTTCGTCAACGCGCTCGTGCGGGTTCATCCGA
ACGCCTTCTACGCGAGAACCACAACGCGTTTGATCCGAGCTCCCGCTTCATCCGGATCTGTCAACAACTTCGACTTGCTGCGATTCTCTTTGAACTTGTG
GCAATTCCATTCCTAGCAGCTTTTCACCCAGAGACGTCGCGCTCTCAACTCATAGCTACGTACGCATGCGAGCTGTTATTCTGCGCCGATATCTACGTCC
AGCTCAACACTGGCTACTACGAGAACGGAAATGTATTACGCGATGCCAAGAAAGCACGACGAAAGTATCTCTCATCATCAGCATTTGCAGCGGATTTAGT
GGCACTCATTCCGTTGTCACTCTTGTTACCGACAAGTATAACCGGATCACGTTCGATTGCCTTGTTGGAAATGCACAAACTTGTGCGTGTGTGGCGTTTA
CCAGCTCTCGCGTCGAATCTTGACGACCTCTACGCAAGACATTTCGAGTCACTCAAACTGACGAAAATGCTTGGATTCACGCTGCTTTTGACGCATTTTG
TGGCTTGTGGTCGCTTTAGCTTTGGCTACAGTCACCCAGCACCCGGCGAGGAACCAAATCACTGGTTGCCTCACGCACCGCATGATGGACATTACAGCAC
AAGGAGACAGTACTTGATGTCGCTCTTTTGGGCATTCGGACTACTTACAGGAGCGCTCGAAGGTGAACTCCCCCATTATAATACCGAGTTCGCGTTCACG
ATCGCTGTGGGGTTATGCGGGCTTACGTTATTTACGTCACTATGCGCAACATTTTTCTTGCTTTCCAAGTGTGAAAGTGGCGACGCGGAGCTGGCTGAGG
CGCGAGTGCATCAGTTTCAGCATATTTTGGCTTTCCACAGGGTCCCAGTGCAACTACAGACACAAGCCGTGGACTACCTGCAGCGATATCATACTCAAGC
TGAAGCTAATGACCGAGAAGCGGCTCGTCGACTGTGCCCTTCGATATCCGTGGACATCCAGGTGGAGCTTCTTGAAGCCACAGTGGCGTTAGTGCCGGTA
TTTGCGGGCTGTGATACTCTATTTATTCGAGCGGTGACTCGCTTGTTAGAGCTAATCGCATTGCCGGGGCGGACACCTCTCTTCCGTGCTGGCGATCACG
GAGATGCCATGTATATTGTTCACACAGGGGTGCTACACACTGTGGTGAGAGGTGTCAAAGTGCGGGAGTTGCGCAAAGGGAACTTTGTGGGCGAAGTTGC
GGTATTTGCTCGACAACCACGCACTGCCACGGTCATTACAGCAACGTATTGCACGTTGTACCGACTATCTAGGATCCATGCTGATAAACTGCTCCAAGGA
TACCCTCAATACGCTGAAGTGATCAACCAGACTGTAGCTGCAATGCTTCAGAAAAGCAACACCACCGCTGTCGAACCGATAAGGAAAGATTCTGATAATC
ACTCAATTGACAACTCCAGTCACGAAAAAGAACCCAAGAAGAAAGTGATGTCTTTTGCGCAGCTCATACGGCTCAAGCAGCTTTTACATGCTCGCGTTCT
TGCCAGAAAGGCTAGAAACAAAAGCACACTTGCTGACAGTGAAGTTGAAGCTTTATCTGTGAAACAAAATCAAGTTTGGGCAACTCCACCATCCCGACCA
CACGAAGCCACAAAGGTGTCAAGTTTTCAGGCACCACGACTAGAAGTTCGGGGCGCTTCTGTTGCTGTGCCTGAAGCTTTGATGGGTCCACGACAGCAGT
CTCCAATGGGACCGCCTTTACTACAAAATTTCCACAGTCCTAGCTCTCGTCGTGATAGTACCCAGTCGTCACGGGCGCATGCCGCCTCCGTCAAAGTTTT
TCCTGCTCTTCAAGACACGTCTGCTGTTGCTATGCCGACTGAACAATCAACAAGACGCAACAGCCAACGCCTTTCGTTTCTTTCTGGTGGATTGGACAGA
CTCGTGTCACTTCGAGATAATTTTTTTCACGACAACGCAGTCAGGCCGTCCGACGCTATTCAAGGCTTCTATGACCGGATTCCTCACCTTGCTGGGCCTT
CAAAGCCACGCTATCGCTGGTGGCACCGCCTCCTCATGAAACGTGGACTCGATGCCGAATCCAACTGGAGGATGATGTGGATTGCTTTGTTAATAGCAGT
AAATTGCTACAATTGGGTTCTAATTCCGCTACTGCTTTCGTTTTCCGCTCTCGATGGACTGCGGACGCGCTGGTATCTTGTCATGCTCAACCTTCTCGCT
GATTTCGTTCTTTGGATCGACATCTACGTTAATCTGCACTTATCGTTCTCAGTCAACTCTGAAAAGATTTTAGCGATAGCAAGGACCGCCGAGCGTTATG
TGTATAGTGGGAAACTCGTCGTTGATGCGTGTTGTGCGTGGCCGTACTGGATATTCACGCCAAGCAAATTCACGCATCCAGTTTTACGCATTCCCAGACT
TATCAGTGGATTTCGAATGCGTGGACTTATTGGCGAGGTGGCTGCGTACTTTAGACTGAGCAGTAAGCATAAACTAATGCTGCTTGGAGTGCTCTTCTTG
ATGCTGTATCATATCGTTGCTTGCTTGTATTTCAGCACCACGTACATCGATGGCTACAGTACCGGAGAAAACCAGTGGCTTCCGTCAGAAGATGTATATC
TCCAGCGCTTGAACTCGACGCATTTCCAGACAATTTCAGGAGTCGTTTTAGCCGCCGGCGGAGAGCGTGTCCAGGAGATTCGAGCGGAGCAATATTTTCG
GTCGTTATATTACGCAGCAAACGTTCTGGCTGCAGTTGGTCGCATGGTTGAACCCAGTAGCGATACGGAGTACGGCGCTGCGTTAATTTTCATGCTAAGT
GGGTTCTTCATCACTGCGATTGTCGTGGACCATGTGCAAAAAGGCTTCACTGCGTCGGCCCTGGAGGAAAAAGAGTTTTTTGCTGCTCGAGCTCGATTTC
AGCGCTTTCTCAAGAGACAAAATGCCCCGTTGTCCATTCATGTTCGAGTGAACTCGTTTCTGGATTTCTGGTGGTCTTGTCACCGCGGCGCCATTATCGA
CGAGTTATTGGAGGATCTTCCTGCCGCCATCAAGCGCGATGTCGTCCACAGTATATGTGCACCAGCAATGGACTCGTTAGAATTGCTTTGTGCCGGTCCG
ACCGTCTCAACTAGTTCAGAAGCTGATGCCAATCAAGAATCAGTGGGGAAAACTACACGGGAGCAAGTGGAGGATATTTTTCTGGACAATCTGAAGTTTG
TGCTGTACGGACAGGGAGAGATCATTTATTGTCGTGGAGATTACGCTGCTGGAATGTTTTTTCTACTGGAAGGTCAAGTGTCGGTAGTACTCGATGGTGA
AGTGCCACGGCACGTCCCGCTTGGAGGTTTCTTTGGAACTGCTGCACTTCAGCCATCAGCTCGTGACAGACGGGAGACTCGACGACGCTCTAACGTAGAT
GGGTTTGCGGGTGTCGGATACGCAGAGCAAGTGACTGCTGTGAGCGGCTGCATTGTTGTGTACATTTCACGTGAACATCTACAAGCGATGCAGAGCGTTT
TTCCGGCTCTGCCTGAGAATTTGCGCAAGTTGGAGCAACATTTCCATGAAGCTCGCGTGACACAATCAGCGGATCTACGATCGCTACAACCGCGCGTCGC
ACTTGGTACTATTGGATTGAATAACCCAACGATGCGTGGTGCGCTGCGCCGCAAGCAAATGACAGGTCTAGTGCAATCTATTGCGAAGAATTTAGAGTGG
TGGCAGAGGGGAACGGCTATTGACCCCGACTGGCCATTCGTGGGCATTTGGGAGGCTATAATGCTCATGGCATCAACTGTGCAGGGAACCTCGGTGATGT
TTTACATTTGCTTTGGTGCAATTGAGACTTCAAGTGGCCGTGTGTTTGCTGATGCAGCAACTGTCACACTGGAATTATTGTTTGTGCTAGATGCCTATTT
GCACTTACGCTTGGGTTTTTACGAATACGGCAATAAGGTTATGGATCTAGCTGTCATTCAACGACGATATCTCCGCTCAATGCACTTCGCGATTGACATG
GCAGCGCTCGTACCGCTCTTCATAATAAACTGGTCGTTGCCATCGAGGAATCTCGAAGTGCTAAATGTCAACAAGATATTGAGATACCTCAAAGGTTCTA
GTCAATTTCGCACGCTCGAGACAAAGTACGTGAAGCTCACGACGGAGCTTCGACTTCTCAAGCTCGTGTACTATTCGTTTCTTGCTTCGCACATGTTTGG
ATGCGTTTGGTTCGATTTCGCTGCTCACAAGTCTGGAGTTCATATCGTTATGAGCGGGTCTGCGGATACGTCCTCGCCATCTTTCGGAGCTAGTGTTTGG
GGTCCGTATGAATCGCTAGAGTCCGCTTCACGTGGACTCCAATACCTTGCATCGGTTTTCTGGGCTTACGGGCTAATGTCGAACTCGAGTCAAGGTGAAC
TTCCCAAGACTGTCGGAGAATGTCTTTTCAGCGTGATTACCATGACAACAGGCTTTTTTTTGTTTGCGTACGTGGTTGGCCATATTTCGGATGTGATCGA
GTTGCAGGACTCTGAAAATCGCCACTTTGTTGCCAAACTCAGTTCATTGCGGCAACTTTTGCGCCACTTCGACTTGCCGCCTAGGGTTGAAGAGAAATTT
AAGAACTATTTCTTCTTCAAACGTTTCCACTCTATCACGCAGGAGCATGTGCTGGAGCGCGTGTTACCTCCGTCACTCGTTGTCGATATGCGTATGTTTC
AGTTGCAACCCATGATTGTCAAGGTGGCATTTCTTGTCGGTATGGAGGACTCGGTCACACGGATGCTCGTGTCACTTTTCACTCAAGTTTTGTTCGTTAA
GGACGAGTTTATTTGCCACTTCGGTGAGGAGGGAAGCGAGATGTTCTTCATCTATACTGGCGTGCTGGATATATTCATTCCATTCCTGTCGCCTTCAGCA
TCGACACTTTCTGGTAGCCCCTCGGTTTTCCCGACTTCAGCGACAGGTGGACGGGTAAGCTTGAGTGGGCTGCGCAAAGTTAACGAAATTACAGCTGGGA
GCTACTTTGGAGAGGCTGCGCTGTTTACCAACACCCCTCGCAATGCGTATGTGAGAGCAAACACGTCATGTATCCTGTACAAACTATCTCGACATTCCCT
TGAACTTGTGTTTCTACGTTATCCCGAATGGCAACAGAAGGTTTTGCATATCGCTAAAATTCAGCAACAACAGCAGCGACTTCAACGTCTTGCTTATGAA
GCACAAGCTCCTGATGCAGGAGGTGGAGGTCGACGTCGTGGAATCAAACGTGCAGAGTCCCGCATTGACCTTGCCAATTCGAAAGCAGAAAATATCGAGC
TTCTTTTTAACCATCGAAGAGCAGGAAATGGGGCTGAGAATACGCCGCGTCGGATCAATTCCTGGATAACCCGACGGTGGCAAAGACCTCAAGCGACGAA
TCCTGTAGTCCGTTGGGTAGTTCCACGACTGCGGAGTCTGCAAGCCATTGGGACGCAACTAGCTTATGGATCCGAAATCCAGAGCTCATTTTATCTTCAA
TGGATGAGGCTAGTATCTATCTGTACGGTATACGTGGCTGTCATGGTACCGTATCGTCTAACTTACGACTCTTTAGACCGATGGAACGTCATCCCGGTAT
GCCTTCGGGTGTTCGAAGCTTTGTGTGAGGTGGTTTTCTGGGTCGACATTTGGTTTCAATTTCACATGCGTACTAATCAAGCGGCTATGGAGCTGTACGA
ACAAGACCAACTGGTAGGATACAAGCGTGAACGGCTTGCTTTTGATCTCGCCGCCACCTTCCCACTGGATCACTTTGTTACGAGCTTTCTGAGTGGTTCT
AGCCGATTGATGCTGTGGAAATGGCTACGACTCAATCGATGTCTGAAAGTCGCAAACCTTGTGTACTACCGCAATGAAATCACGAGACGCAGCGTGTCGT
ACGAGCTAAACCGCGCTCAAACACTCTGGCTGTTGTATCTGCTGGCAATGTTTTGGACATCGTGTGCCTATTTTGCTGTATCAATTTACGATGGCTTCGG
TACAGAGTGGCAAAATTGGTTGCCATCTTCTGTACTTGAGGCCGAAGACCCATCTCCTGACCTTTTGATGCTCAGACTCTTTCGGGGGTTAGCCTTTGCA
GTCACCGTCTTTGTCAAGAAAAGCAGAACATTTGTACCAGCGTCACAGATCAACTTTGCTTTCGCCATCGTCATCTCATTCGTCGGTCAACTCGTTATGG
CTCTCATGATTGCCGAAATGGCCAACATTTTTCTGCTGTATATTAATAACGAGGTGCAGTTCCGCAAAAACCACCTAATAGTCGAACGCTCGCTAGCCCG
GTGGAAAGTCAGTACAGCATTAAAGCGACGGGCAGATAACTTCCTAACCTCGTGGTGGTCGTCTCATGCGGGTGTTGATTACCAATTGATTTTTGACGAA
CTTCCTGCTAGTGTGCGCACAGAGGGTGTCCTAGCTATCGTAAAAGAACCGCTGGGTCTATTCGCACATCACGTGTTTAGGCCACTCCTTCATGATGACA
TGAAAGGCTTAATCGAAGGAGAGGTTAAAACGGAGAGTGCAGTGGTCGAAGAAGCTGGAAATTCGTGCCAACCTGAGCATGGAGTTAAATTTCAGCTAGA
GAACCTCACGTACGCAATTGCGAAGTGTCTGCGTTTTGAAGGATACCCCCGGGGTGAGAATGTTATTGTTGAAGGAAGCGTATGCAAGGCCATGTATTTC
GTAGTTCGTGGGTATCTGTTGTCAAAGAGTGTGTCGAATCCGGAGATGTATCCGGTCAGCCGCTTTCGAGGTGGTGGATATTTCGGTGAAACTGGTCTAC
TAGGTCACTCTGTTAGTCTAACGACGGTGACCACCATGCGCGCTTGCGACCTCTTCGTACTGAGCTCGGATCATTTACTCCAGGTACTTCAGTCACACTC
ATACTTCAGCTTGGTGCTGGCTACTGCACAACTAGCGGTTAACCAGAAGAAGACGGCTGCTGTGTTTGTGGCGAACCGGTTCAAAAGCGATGACTATGAC
GAGGATATCGAAAGTAGCGACAGCAGTAACGACGATGTCAGTGATGACGATGCGAGTAAGAGTGAAAGTGAGAGCGAACATGATCAGGCATCTGATGGCG
CTAAGCTGAGGCGCGCAAGTCAACAACTAAAGCGAACTCTTCAAGGAGCGTCAGAGGAAACAATGCGGATTTGGGAAGAAACATTTGCGTTATTCATGGA
GATGCTTGTCCCCAATGGAAGTGTGG