Description :
From Genome Similarity Track
Location :
Scaffold_59:93000- 94273
Transcript NameFunction/comments
Phyra_81354endo-1,3(4)-beta-glucanase 1, putative

Sequence
1273 bases(100 bases per row)
GTCTGCTTCACTTCGCGCTACCACACCAGGTGGAATCGCTGAGCGGGTCTCCGACGACGGCGGGCAGTCAGGGTGCTATCGTGATGCACTCGGCGACGCG
CGGTGTGATGGTTGGTCAGGTGACGACAAACCCGACGTGGTCTTTTGTCGAGCCAGAGGCGGACTTCGAGGTGGACTTCTACCCTGTGCGTAAGCCATCT
CCGTGGATCGTGTTAGAGACTGACATGCTGAGGACACTGCAGAAGGATATCATAGCGAACTGGTCTGACTGGAACGCTAATAGCTGGTATTACAACGGCA
AGTACTTCCAAAAGTACGCGTCGCTGTGTCTGATGGCAGCCGACAGCTCGGTGGTGGGCCCGGATACAACGTTGCTGTCGTACTGCCTGGAAAAGTTGGA
GAATATGATCGAGCCCGTGCTGAACAATACGTTGTCTCCTCCGCTCATGTACGACACGCTGTACCGCGGCCTGATCTCGAGCTCCATCTTCCAGACAGGC
AGCATTTACACGGAGTTCGGTAACGGCATGTACAACGACCACCACTACCACTACGGCTACTTCGTGACGGCATCGGCCATTCTGAAGCACCTAGACCCGA
ACTGGTCTCGGATGCCAGAACTCGAGAAGGTCATCTGGACGATGCTGCGCGATGTGGCTAATCCGAGTGCCGACGACACGTACTTCCCTCGTTTCCGTCA
CTTTTCCTGGTATTTAGGTCACTCGTACTCGCACGGCGTGACTTCCATTGACAATGGTAAGGATGAGGAGAGTACGTCGGAGGACATCAACTTCTTCTAT
GGTATGACGCTATGGGGCCGGGTTACTGGAAACAAGGCCGTGGAGGACCTGGGAAGTCTGATGCTGCGTCTCGATGCGCATGCCATTCGCACCTACTTCC
TCATGACGTCCGACAACACCGTTCACCCGCCAGCGATCGTGCGCAACCATGTCACGGGCATCTTCTTCGACAACAAGGTCTACTACAACACGTGGTTCCT
GGACGAGAAGTACGCGATTCACGGCATTCAGATGATCCCAGTGTCTCCGATCAATCAGCTCGCACGTACGTCGACATTTGTGGAACAGGAGTGGAATGAC
ATCCTTTCGAAGGAGCCGATTGTCATTGAGGTCAACACAACCATTACGTGGCTGTCGCTGCTTCTTGTGAATGCCGCGACTGTCAACCCGATTGAGTCGT
TGCACAACCTCAAGAACGCGACAATGGACGACGGTTTGTCACGATCGTGGGCGCTGTACAATGCAGCTACTCG