Description :
From Genome Similarity Track
Location :
Scaffold_3765:93- 2133
Sequence
2040 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCC
TCCTCCTCCTGACCCACACCCTTCCTGTGAGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTC
GTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAATTAAGCGGTCGGACACATCCACTGAAAGACGGATCTGTGGCCGAT
CCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCCAAT
CTTCTCGCTCACCCGGAACGGTCCAAGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACT
TGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGACCCTCTATCGCACTCCGCAGTCGTTCGTTCACCTGGAATCTAGCTTGCCGGTAGT
ATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGATTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCC
ATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCC
AAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGAACGATATGCCATGGTTGCTCGCTGTC
GCTGCCTTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAGTCTTCGGAAAAC
GCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCACCCAAATCAACAATTCT
GTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGA
TTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACGTATCGTTGTACGCTCTTGAATAGGCCTCTCCAGTGGAAACATTCCCGGATCCG
TTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATC
AATCCATCCCGGTCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATT
TGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTAAGGATCCGCTTAAT
GCGGACTCCCTTCATAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAACCCTTCCTCTGGATTTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCG
GATCCAACTACCACCACTTCGTATAGTCGGTTCAATGTAACGAGATCCTGACGCTCGGTCTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGG
CACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTT