Description :
From Genome Similarity Track
Location :
Scaffold_2855:93- 1412
Sequence
1319 bases(100 bases per row)
TTCGAACAGCTTCTTTAGCGAACGGGGTTATTTCGCTGGTTATTTTGTATTCACACAAAGGTCGTGGGCATGTATGCCATTCGCTCCACCAAAAGAGGGA
GTCAGCTGTTTGCTGACAGAACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCG
ACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCCGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGA
ACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTAATGAGTCATGAACCCACCTCTGCTAGG
AAGCAGAAGCGCTTTTGGCGCGAGCACGAGGTCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTG
AGGGTTTACGTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCAGGGTCAATGACCAATCTGCTGGGTCCTGGTGAGACGAGCGCGGAGTGGCGCGTA
ATCCACTGAGTGGTACGAATCTGGTCGATGGCCTACCGCTGCGTGACCGGAGGGTCGCGGTCGACTGCGAGTCGAGCATCATGGGCGTGCCCAGGGAGAT
GCAGGTGAAGTGACACCTAGCTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAAGTGTCTTGCGAGACACTGTATTCTCTTCGAAGGAGTGA
TGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGTCTAGTCGCGGGAGGGAGAGGAGAAGAAGACGCAGGGCG
TCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGA
CGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCAAAGCCTT
AAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAG
GCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAATATGGAGACGTTGTCTCAAAAGACCCAC
CGACGGGCCTGCCTCCGGA