Description :
From Genome Similarity Track
Location :
Scaffold_4280:93- 1136
Sequence
1043 bases(100 bases per row)
TTAGCCCTCTGCAATCCTTCACCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCT
CAACCCGTCGATCCCTCTGCAGGATATTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGCGGTCAGGTGGCTCCGCCGAGGGCTCCACTTCTCCGAG
CGATTTGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCTAACCATCACCCGATCTCCTCATAATGGCCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACTTGGTCCTTGGA
TTACTGTAGGCACTCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAATTCCCAGGTTTCTCCGGGCTCGAT
CCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTC
CCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCAGT
ACACCAAACAACCTGCCAGCGTGATCGTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGGCTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCGTTGTTGATCTTGCCC
CCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCCACATCCTCAGATC
CACGGGATCCAGTGACCTGACAGACCTTAGGGGGATCCGCAGT