Description :
From Genome Similarity Track
Location :
Scaffold_7:929974- 937867
Sequence
7893 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGCGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TTGTTGCCATGGATAGGAACGACCTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATATTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAGCACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATTTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAATCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCTCTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGAAGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGGGTTGGGTGTA
CACACGGGAAGCAACATCCCCTCGACGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCAAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGACACCCACTCA
GCGAACACATCAAGATGACTGTGTTGATGAACGGCCTTCGAGTGAGCCCCGCACGCCCTCAGCTCTTCCGGGTGCATTCAAGCACTCTTGAAGAGGCGAT
TCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGCTCTTTGTCGGCTCCCGGCCGAACAAGCCCC
AACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTACGGGAAGATGTCCACTGCAAGCGCGACTGTCCTGTGGA
AAGACTCTGCAGACGACCCTTCCCCTAGCCCGTCCACAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCTGGGAACCAGTAGGGGCGG
GGCGCCCTACTGGGGAAGAACTAAGTCCTTGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTTGCACTCTCGAATCGGC
GAAGAGCAGCGGCAGTACACGAATGGGTACGGGGATATGATCATTTCTTTAGAATCCTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGAC
GGTTGCTCGCAACCGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGAGACGGTGCAGTGCGACTGGCCGACGGGAAGGCCGTCACTGTTC
CCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGGTCTTGACATGGATCCATACTATATGATCCTGGGCAT
GCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGTCAATCGGTGCCAGCCGCCCTGCGCCGTCCGACCGAGCATTGGTGAGTCATGTT
CCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATTCGACAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGG
ATGCTTTGATGGTGGCAGTGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCAC
GAACACTGAGAACAGCGTGTTCAGAGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAGCACGCTTCCTGTGTG
GATAACACAGTGCCACACGCGGTCGCCCAGACCTTTTCTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGA
GTGCCTCGGATGTCGTAGCAACACCATTTCTAGACGTAGTCAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGTCCCCGCCGCCTCAAGTCGGA
TCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGGCTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGGTATCACATCTTCGAT
GGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACATCGAGGAAAGGACGGCTGAGTCTT
TCCTGACCAGCCTCAAGGCTGGAGAGCTTGCTGGGATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTTTTGGACGAGAA
CGTCCTGGAAGACCTGAACAAGCAGCGTCAGGCGCCCTTGGGCTCTGAGATTCTAAAGAACCCCAAGGATACGGTGTATCCTTTGGTAAAGGCGTCTGCG
GACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGGGCCTGGCACAAAGTATTGTGTCACGAGGC
AATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCACCGCAAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGAC
GCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGCTCACGCTTATAACAAGCTGATCAACGCAACGGTGCCGGCCCAAACACCGATCCCA
CGAAAGGATGTGTTGTTGAACAACATAGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACA
TCCCGCTCACCGCGGTAAGCACTCCAAGCGACATGCTTTGAGAGTGGCTCGTCATGCCGCAGGGCTTGTTTAACGCCCCGGCGACGTTCAATCGCCTGGT
GACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACATACGTACTTCGACGACATATTCGTTCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAGGTG
CACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAATATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAACGTTC
TCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAA
GTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGC
TGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCTATCCTGGCCCTGCGGACGAGACGAAGCCGTTTAGCGTCGTC
TGCGATGCCTCCAATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTAGACACGAATGAGTCATCTCGTTCCAGTCCAGCCAACTCAAAGCCG
CCGAGCGGAACTACCCGGTCCACGACAAGGAGCTCATGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGAT
CTACACAGACCACGCGTCCTTGAGGACGGAGACTAACGCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGC
GTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTAT
ATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCG
TCGCGACAGCGCTCACGGCTCCATCGATATGAGTTGAAGGAAGGACTCCTCTATTACCGGGTGGAGCCCAATGATCCTCCACGGGTAACGACGAGGATCT
GAAGTTCGATATCCTCGCGAGGCGCACGAAGCGCCCTCCAGCGGCCACTTAGGCCGCGAGAAGACCTTCCTGTCGATCTCTCAGTCCATCTGGTGGACCC
ACATGTACAAGTGGGTCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCGCTACAGAGCCTACCCGT
ACCGGCTGACTGCTGGAAGTCGATGAGTCTTGATTTTATCTTTGGGCTTCCCGCCGACGAACACGGCAACACCGGAATTTTGGTGCTCGTGTGTCGGCTG
AGCAAGATGATACATCTTGCTCCGGTTCCCGTCACGATTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTTTTCCGCTATCACAGTCTCCCGG
AGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCTCTTTACTGGGAAATCGTCTGCAGATGTCCACTGCGGACCA
TCCGCAGGCAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTT
CCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTC
TTCGAGGAGACACTGACTCCTCTACTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGAAAACA
GGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGAAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAT
GGAAGAGGAAACTCAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTATTGACACTGTCAGCTCTGTCGGCAGCAACAAGC
TGAAGCACCGCTTCATCAGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTA
TGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGAGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCG
ACGAGGACGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGGCCGTACTCCGGAGAGGCTCCATACGAACGGACCTCGACGCC
ATACGCCGAGTACGCCGGGTACGCACCATACGCGTACATCTGGGAGTGTGCCGCAGGCGGCTCCGGCCGTGGCAACAAAGCCTCGATCCGTCGGATCATG
CGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGAC
GAGCGAGCTCGCCCTGATTCCCGGTCTGGGCGGCAGCGTCGCCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTC
AACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCC
CCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGT
TATGCCCAGTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCACAATCTGGGAACAGAAGCGGCGGCAGCTTCATA
AGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGTACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCGGGCCGTCC
CTTGGCAGCATACGCTTGCTAATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTA
ACCCCGTGGGTGAGTACTTAAGAGTCCCCACCCATGCCCAGGACATGTCCTCACAAGAACTCCACGAGGGATAGTTCTCGGGCATAACCCAGGGGTATCC
CCAAAGAGGATAGAGACCACCCCAGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAATCACACACCGAGCA
GCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGGACCTTT
AAGAAGAGGTCAGTCCCGGAGCTATCCGCGGGGGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGAATGCCACCACCGAACCCCCGCGCA
CACGCTGGGCAGCTTGGAAATCCTCCTGCAGCTGGTCGAGGTCATTCGAGACCTTTCGGGGTTCAACGATAGCACTCTCCTCCTCCTCCTCTTCTTCCTC
CTTCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGAC
TTAGAGGCTGTGCGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCATGCGCAAGACCCTCGGCAAGCGGGAGACGTTTGCGAGAAGTCT
CTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGGCGGCCGGACTCTCGGAGCGCACAGACGTTCTGGGACTGTGATCACCTTGATCACTAGC
GAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTACCCTCCCACAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCATCG
TCCTCACTGCCCGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGGCTGAAGGAGAGGGCGACGGACTGCGGCGCTTGCTTGCTCGCTTGT
CTACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTG
CGCCGTACCGGCAGCTGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAACGGTCCAATTGGAGACCTAGACGAAGAGCACA
CAGGTCGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCCCGCGCGGCCAATTTGATGGTTTTCGATTTTGAGAACAAGAGTTTGTGACGAA
CACCTCTTCACTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGATGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACA
CTTCACACTTCAGGTGTATGACACGTCATACTCCGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTCAAACGACATTGCATTTCT
ATAGGTAGCTTATAGTTTGTATTAAGCCAAACTTAGCCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAACTT
AAGAGTGGACCTGTGAACTGCCGTTCACAGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA