Description :
From Genome Similarity Track
Location :
Scaffold_121:92991- 94467
Transcript NameFunction/comments
g10468.t1XP_009526646.1 hypothetical protein PHYSODRAFT_503646 [Phytophthora sojae

Sequence
1476 bases(100 bases per row)
ATACCCATTCGCGAGATTGTGGCGGGCGATGCGAACCGCAGGTCGTGCGTCTCAAACACGAAGTTGACGTTCGGACCGAAGTTGATACGCTCACCGTTCG
GCAGCGTGAGCAGGTGGTTGTCGTCCAGCACCGAGTTGAGCGACTCAATCCATTCGGGGTCGACGTCGCCATCGCAAATGATCCACGAGCGCACGTTCTC
GGGCTCTTTAACAACCTGTCGCGCTGCTGCCGTGAGGACACCGTCTTCCCATTCACGAGTGTCCAAGTCCATGTGGCCCAGCAGACGCTCGCGCGGCATC
GACTTGGGGTTCATAACGTGCGTTTTTACAAGCTGGCCACATCGGATCAATGCTTGCTGCAGAACCTGCCACACCGTGGACTTGCCACTACCCGAAGGCC
CCACAACCACGCAGCCCATGCGCTGGTCCAGCGACTCCTTCAGCTGCAGCATTTTCCTGATCTGCAGCTCGTCTACTTCCAGGAAGAACGGTTTGCTGGT
CATGACTTCATGAATGGCATCGCCTAGAGCTCCTCCTGCTAGATCAGCCGACTCGACGCCAGGGAACACGTCTCCGATAAGAGCCAAGAATCGGGTCGAG
TCCACGAATGTGAGCTTTGACAGCGTGTTGATCCGCACAGCCTTGATGAGGATCTCGGTTTCTTCTGCCGTCGTCATTCGCACTGGTTTGCTGTCCGCCG
ACTTGGATTCCTCTTCTCCGTTACCGTTCGGTTTGCCAGCATTGGTAGCTCGATCCTTCTTTTCAGTCTGCAAGAGCTTGCCAGCCGTGTTGAGTACTGC
TTTCAGAGCACGCAAGCCCCAGTCGTAGTGCTGCTGGCGAGATAGCAGTTGTCCGGACAGCGAATAAAGAGAGACAACCTTGGACGCGATGTCTTTCGCT
TCGCTGAACCCCTCCGAGTAGAGGATAACTTCCGCGATGAGGTTGTTATCCGGTCGACCCATTGCCACAGGACGGAAGAGTGCCTTGAGGTTGTCAGGAA
GCTTTGACCGGCCACCGTAACCTTTTCCGGCGGGGTTGAGCGTCACGAAGATACCAGCGTTGAAATCGACATCCACGGAGCGATTCAACAGGTTGATGGT
TCCTGTTTTCTCCTTGATGGCGTCCTGGATAACCTGAATCTGCTGAGAAATGGCAGAAAGCTGGTCCTCCTTCAGACGATTGAACTCGTCAAAACAGCCC
CAGGCACCGCACTTTACCAAGCCGATGAAGATGCGGCCCATAGATTGGAAGTCGATGCCCTCGTCGCAGTTGAACACCAACACTTGCCGTCCAAACTGCC
CACCTAACGCCTTCACGGACTCCGTTTTACCTGTACCAGCAGGTCCGTACGGGTTACCTCCGAAGCCCATGTGCATGCCTTGAGTGAGCGTAAGGTAGCA
CTTGTCCGTCAACGGAGTGTGCACCAGCTTCGGCGCATTGCCCTGGTATTCGTACGTGTAGGCAAATTCAGCGTCA