Description :
From Genome Similarity Track
Location :
Scaffold_59:92974- 96291
Transcript NameFunction/comments
Phyin_T30-4PITG_17646Putative uncharacterized protein

Sequence
3317 bases(100 bases per row)
GCTGCGCTCCACATCGCTCCTGCGTCCTGCCTGCTGGTGCTTAGGGCCCGATATCTGACGCGCCGTCATTACTGCAGACTCCAGTGTGCCTCATGCCGGT
AACGTGGCCAGCGAAGCTCGGATGGGACTCCGCGTGGACTGTCGCGCCAAGCTCAGCCTGAGCACCACACCGCAACTTGCTGCCAGTAGCGCTGCTGGTG
AAGCCTGGACAAGACGCTACGCCATCGCATCCTGTAGCGCTGCAGTGAAAGCATCGGATGCTACCGTTGCGGTGTGGGTTGGCTCTGTGAAGTGTGGAGG
AAGAGCCAGGACTGCGTCCAGCTCAAACCTGAGGCTCAGGTACCTCCAGGACGCGATGCTCGCGTCCAGAAGCCGGACTTCGACGGACCATTGGCTGGCG
AGCCGCCAGCCCCATCCTACTGCTAATCCTACCAATATATGTTACCGGGGTTTTTCCTTGTGCTGCTACACACTCGACAACTTGCGCCGTCAAGAGCAAG
CAGCAGCACTCGGTTTTCTCCCCTGCTGGACTTTCAGTCCTACTGTTGTTACGACTACTTCCTTCATCGCAATGGTCACCACTCGGCGTAGCCGAGGAGC
GACCATCACTCAGGTTATGAGCCCAAGAAGGAGAGCTGGAAGCCCAGTCCGGAGTACGCAGAGCTCGCACGCGTCCGACGAGTTGCAGTTGCCTGCAAGA
GCAGACGAGACAACGTCAGACGAGACACATGCGACGTCACAAGCGTCATCAACCCGAGTTGAGCAACAACTCGAGCTCTTATTGGCCCAATTCGGTACCG
TTATGACTACACTGACAAATCAGCAGCAAGTGCAGAACATTCCAGTGGAAGCATCCACCCGACGCCCACAAAGGCAGCTCATTCAAGAATTCTCAGCGGC
TCGAGCACAACCGCAGCGAGTGCCGACGCCGTACGGGCCCCGCCGAGGAAACCCAAGCACAGAGGAACTTACCGCCGACGCCAGCACGCGTCAGAGCGAG
CCGCCAAGAAACCCAAGAACGTCCGAGGCTGCAGCGCAGCCAGTCCAGACCGAGGCCGGGACCGACTCCGCTACGGACGAACCCATGGTTGGAGACCACA
GATGCACGCGGTGCATGAACCAGAGCGGACACGTGCAGTTGAACGCAAGACTTACCGATACCAACTACCAGACGTGGCGCGTCGAGATTTGCTCCATTCT
CGACGTCGCACACCTCTTGGACCCCATCATGGAGCGCGAAACGATGGCAGACCAACGTAACGAAGGACAGCGCGGCTGTTTCAAGCAACGACTGCGTGTT
GCTCAACGTGAACTTACGATGGGACTTAGTCAAGAGCTACAGATGCGATTTACAAGTGTTATTCAACGTGCTGATCCTATCCTACTGTGGCGAACACTGG
AAGATCATTTTGATAACCATCCTGGAGTAAACAGCGTGTTTCTCAAGCGAGATATGCTGAATCGTCGCCTGCAACGTGACGAACGACTTGACGATTACAT
TCGTGACATCGACGACTACCAACAGAGACTTCGCCGCGCGAACAAGCAGCTGCCTGAGCAGGAAGCCGTCTCTATCCTATTGTCGAATACAGTGGGTGTG
TACCCAGCGGTGGTAAACGAGCATGAAGTACGTATTGGACGTGATGAGTCCATTACGTGGGAGCAAGCGATCGAGCGCCTTCGACTCGCTGACCACTCAC
GCCAAGAGACTGAGCTACAGCAAGGACGTGGTGGAGGTGGACGTGCCGTCCAGCGAGATGTTGCATTTGTTGGTGGCCGTGGCGACGGACACAACGACGG
AAGAGGACGTCGAAACTCGAGCAGCAGCCAAGCACGAGGCAACAACAACCGCAACAATCGTCGCAGCCGCAGCTCATCGCCGCGTGGGCGGAACAAGCGG
CAGAAGAGCAAGAGCTCATCCAGTGCGAGGGATGACATCGCCAAGCGAAAGGCGAAGACAAAGTGCAACACGTGCGGAGAGCAAGGACATTGGAGTGGCG
ATCCTGAGTGCCGCCAGCGTGGCAACAGTAACAACAACAACAACTCGAGCAACCCGCCGCGCAGGATGATCGATGTGGTTACTGTGAAGACAGCCAAGTC
GGCTGCACCGACTCAAGCTGAAGGACAAGAGCATGTACTCGCGGTGCGTGACAGCTTCAACTACAAGGACAAGGACCAGGACATGGTGGAGTGGGTGTTG
GATAGCGGCGCGCAGACCAACGTCTCGAGCGACCTTACCTTGTTTACGGAGCTACACGAAGACTCAGTTGCAGAACTAGTCTTCGGCAACGGCACAACCG
AGCGCGCAACTGTAGGCACAGTGCTTATGCAAGTGCTGAACGAGCACACGGGCAAGATCGAGGAGCGCCTCCTTGATGACGTGAGCTACGCCAAGTCGGC
TGCCTACAACCTGATCTCGCAGACCTACATGCAATTCAAAGGAAACTTCAAGGTGCGCATCTCGCATGATCAGAAGACTACGTGGCTGGTCAAGGACACA
TTGAAGCTGCGCTTCAAGTACATCCGCGGGATGTACCGCATGTGGACGCCACGTCAGAGCAAGAACGTGATGAGCGTCAAGGCCAGTGAAGCTGAGAACC
CCATGACGTTGCTGCACAACCGCATGGGCCACGTAAACATGGAGACTATCAAGACTATGGCAGGAACCTATAACTTTGGCATCAACATGCAGTCGAAGAA
TTTTGCTCTATGAATGCATTCCATGCTTAGAGTCAAAGACGAAGCGCATGAGCTACAAGCGCAAGCCGTCTCGCTCTGCAAAGCCCTTGCACAAGCTTTG
TGTCGACCTATGCAGTGTTGGAGTGGATACAATATCGAAATCAAACCAGTTTCTATTGATTATCGACGAAGCTACGAGATACAAGTGGGGATATCTATTA
GCCTACAAAGACGAAGCCACGGAGCTGATTCAGAAGCAGGTTCGCTGGATCCAGAACCAGTTCCCGAAGGCGACCATCAAGACGCTGTTCTCCGATGGTG
GTGGCGAGTTCGTCAACATGCAGCTCGAGACCTTCTGCAAGGACCTCGGCATCGACACGCGTTCATCCAATCCCTACAGCCCGCAGGAGAACGCTATCGT
GGAGCGCACGAACCAGAACGCCATGCGGCAGGTCAGATCTATGTTACAAGCTACGCAAATGCCTGTTTCATTATGGGGAGAAGCCTTCCTACATGCAATT
GAGACGCTCAACAAGACGCCGACGCCGGTGTTGAAGGACCAGCAGTCCCCGTACGAGGCCCTGTACGGAGAGCGGCCAGACCTCAGCGTGCTGCGCACGT
GGGGGTGCTTGGTGCAC