Description :
From Genome Similarity Track
Location :
contig_164:9297- 10934
Transcript NameFunction/comments
g13978.t1hypothetical protein

Sequence
1637 bases(100 bases per row)
ATTCACACGAAGTCGTTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCACTCTGGATACTCGAC
CAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGTTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGC
ACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCAT
CGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCG
CAGGCGCGTTCCGTTGCACAACCCGAGGTCGGGCTTTAAGTTCCGCATCATGATGATCGGCATCTCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCA
CTGATGTTCAGGGAGTTGAGTACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCAGTCA
TGCGATCCGCTACGGCTTTGTTGATATGATGGATTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTATTCGTCCGTTGCGACTTCCGAATT
GTTGATCTCGGAGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATTGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGACGGGGTTG
TTGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTTTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACG
CAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAGTGGCCACAGTCCGGAAGACTTC
AGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTT
CTGCCTCATTATCCAAAACATCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCATCCCAAACTATCAAACTTGCTTT
CCTCATCAATTCCGTGACCTGAGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAAGGGATTTTGAAGGTAGAATGCGCTGTCCGACCT
CCCATAAGCCGTAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGACCAGTATGTTCCGAAGCAGTGTCGATT
TCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGTTCAAGCACTACTCCTC
ATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGC
ACCAGGCGAGGGTACTCGCTCAGCTGAGGGAGATTGT