Description :
From Genome Similarity Track
Location :
Scaffold_273:92954- 95756
Sequence
2802 bases(100 bases per row)
ATGACCGAGCTCAACAAGAAGCTGGTGTCACTCGGTTGGGTATACGAAATCGTGAGAGCCGTTGGTGTTGCCCTGCTTTACCTGTGACGAAGCCAAACAC
CAGCGAATTTAGACAAGCTGTGGATTATCGACCTACAAATTCTGTGACCGAACCGATTGCCGGCGTAATGCCAAGTCTTGAGGTAGTCCTCGAGCACTGC
AAAGGAAAAATGTTTTACGCGGTGTTCGACTTCTTAAAGGGATTCTGGCAGCTACCCTTGGACAAGAGTTGTCTAGAAATGCTCTCTTACATGACAGACC
GAGGTGTTTTTACACCTACGCGAATACCTCAGGGGAGTACAGAGGCAGCACTGCACTTCTAGTCAACAGTGGAAATGGTATTGGGCGATCTGGTGAACAA
GAGCGTTATAGCATGGATTTATGATTTGTTGGTTTTCGCTGACACTGCAGAAGAGTTAGTGGATGCGATCGATGCTGTACTGGTGAAGCTAGACAAGCAT
GGACTTTTGCTCGGACCAAAAAAGAGTGTCCTCTTTCTTACTGAAGTGCGATGGTGCGGTCGTATTATCAACCGACTCGGGATCGGGCACGACCCAGAGC
GAATCCAAGCTCTGCGCGACATGCCCGTGCCCAAGACCGCTGCAGAGTTGCAACAGTTCCTCTGTGCGAGCAACTGGATGAGGTTAGGGCTCGTAGACTA
TGCTCAGGTAGCTCGACCACTACAGGAGCGGCTTGATAGCTCTCTTACCGGCTTCAAAAAGACGAAACGTATCGCCGCAGGCATTAAGCTGAATTTGACT
GAAGCTGAGATTAAATGTTTCAACGCTGTGAAGGACCTGCTCGGCAATTCGGCAATGCTAATATTTCCAGTCCCGGCCCAACAAATGTGTGTTTTGAGCG
ATGCTTCTGACTATGGATGGGGGCTTGTGGTCACACAAGTGGGTCAGTGGCAAGATGATGTACCCATCCACGAACAGCACCACGAACTGCTCGTGTGTAT
GGGCGGGAGCTTCAAAGGCTCTGCACTCAATTGGAGCGTCATTGAGAAAGAGTCTTACCCAATTGTACACGCGTGCGAAAGACTGGAGTACCTACTCCTA
CGACCCCAAGGTTTCAAGCTTTACTGTGACCATCGAAATATCGTGTATCTCTTCGCTCCGAACAAAGAACTGAAGAAGCACGTCCGGGGTAAATTGCTGC
GCTGGTCCACGAAGTTATTGGAGTATAGATACTCGATCGAACACATTAAGGGAATCCATAACGTGTGGACAGATCTGATCTCAAGGTGGGGCGGCAAACC
CCTACCTACTGTGCGCATGCAGTCAGCCAAGAGATTCAAACGTGCCAACCGGAAGCGTGGCAGCAGTGCAGTGACAGGCACAACACCACCACCGTTGCGT
CCACTAGATCAGGACGGATTTGTGTGGCCCACTATCGAGGAAATCGGAAGCGTGCAAGCATTGCACGATGCGCCAAAGGGTGCAACGCTGAGTAAAGATG
AACTGTGGCTCGTGAATAACATGATGTGGATACCGAGTGGAGCTCACGACCTTACTCAGAGACTTCTGATAGTCGCTCATTGTGGTAGAAATGGACACCG
CGGCATACATGTGATAGAGAGCCACATTCGCCGGATTTTCTACATTGGTGGCCTCACTAGGATTGTAAAGGATTTCTGCTTGAAATGCCTACTCTGCCTA
CATGTGAAGGGAGGGGTGGTGATCCCCCGACCTTTTAGTGAGACCCACTATACTTATGAGCGGAACGAGACGCTACACTGGGACTTTTTGACTCTGGGCG
ACTCTTTTGGTACCTCTCGCTACACGCTCGTCCTGAAGGACGAGGCAACCCACTTCACAGAGCTGGTGGCTTGTGACAGCCCAACATCTGAAGTTGCAGC
GAGTGCCATCCTGGACTGGTACAGCCGCTTTGGAGCGCCGAGGGTGTGGGTTAGTGACTCGGGATCACATTTTAAGAACAAGGTGGTGGCAGATCTAGGC
CGGAGACTGAAAAGTCGCCAAGAGTTTGTGCTAGCATACTCACCTTGGAAAAACGGCTCAGTGGAGCGCGTAAACCGGGACATCTTGCAAGTACTAAAGG
CACTGGCACTTGAGTACAAGATCAGCTTGCACGACTGGCCCTACCTACTCCCACTGGTACAGTCCAGCATAAACCACTCACCGGTACCGTCACTAGCTAA
CCGGGCTCCGATTGAGTTATTTACGGGATTGTCATGTCCCAGTGCATTGGACACGGTATTTCTCCCGGGAGGAAAGGGGCGTGTAGCTACGCTGGACCAA
CCAGCGCCAAGTACAGTGGAGCGACTCACCAAACTACGAGAAAACATCCGCAACATGCACAAGTCTGCCAAAGAGGAGCGACAACGCCAGGCCAACTACG
ACCACACTATGAGCAACCTGTAAACTTCTCGGTCGGTGATTACGTCCTACGTTCTCGTGTCGATGAGAAGTTGCATGCGAACAAGCTACGAGTGATGTGG
GTCGGTCCGTATCGCGTGGTTCGCAGTGCTGACTACTATTTTACTGTGAAGCATTTGGTCAGTGGAAAAACAATGAATGTGCACCCATCTCGTCTAAAAC
TGTATGCAGACGACTCACTAAATGTGACTGAGGAGCTTCTCGACCATGTTGCCTCTCAAGGAACACTGCTGGCCGTAGAAGCGATCGTGGGGCACCGATT
GAATGCAGACATGCAGGCGTATGAGGTGAAAGTAAAGTGGCTTGGCCTTGAGACCGTCGAGGACTCCTAAGAGCCTTTGAAGACCATGAGTGAAGATGTA
CC