Description :
From Genome Similarity Track
Location :
scaffold_35:92907- 94204
Sequence
1297 bases(100 bases per row)
AGATGAAGGCCACTTAAATTAGCCATTGCCGCTGTCCCAAAGGGACTAAGGGGAGTGGCATGGCTACTTAGTGCAAGTTATaccgacatggcacgaccCC
TCACTAATCTTCTCGAACAGAGCGCAAAAGAGGCGGCTTGCTAGGCAGAAAAAAAGCTTAACGAATACACAAATTCTGGCCCTGCTGAATTCGGATTGGT
CATTCCATGTTGTCTTAGACGCGTCAGCCTTCGCCATAATATATGCTTTACTCCAAGCAGATGTTGATGGGCATGAGGAAGTCATCGTTTGAGTTTCGTG
CGCTCAAAGCGGTAAAAAGAGATATCTAGATTATGACAAAGACCGACTTGCCATGAAATATACCCTTGGCAAGATCAGGGTAAAACTTCTTGACTCTGGG
TCATGCCTCGGTGCACATAGTGCTATCGTGACCAAATCGTCTCCTCGGAACCTTCTTTGCCGAATAGGTCTTTAAGGTAAGGTATGATCCGGGTGGACTT
GATGTGGTGACCGATGCGCTTTTGTGTCGCTTCGACTTTAAGCTGTGGTTTGATACAATAGTAACATCGCGCATCGATAAGGCAATGTGTACAGTGTATG
GGACGCACCATGTGTTGTATTGATGAAGACTTTAGAAATCAGCAAAATTTTAGACTTATTTACTTCTTTATCGAAGGTTCTGGTTGCGCATTTGCATCTT
ATCCCGAGGACTGCTTAAATACAGCACTAAACCAAACGCCTCTCAGTGTATTTTGTACCTCATGACGAGGGTATTAGGTATAGAATACTGTTTCTGTGCA
CATGAGATCTCCTTTAGTGGCCACCTTTTAAAAGAGAAAAGACATATTACTCGGTGCGCATTTAATCGGTGGAAAAGACAATCGGTGTATAAATGGATAC
GTGCTAGTTTAAAGATGTCAGCGGGTCAAATTCTTACAGCATGTATCGGCGCATCTGCCAAGTACACATATTTTGACAGAATCTTGAAAGTCCAGTAGTC
TGATTTTTTCTTAGTAGACGAGGTTGGCAATTATGGCCAGGCGGCATTTGTGCATCATctgaacaagatggctcgACTTGCAGCTGTCAGTGTCACCGGA
GCTGCTTTTTGGATACAGTCGAACTGTTACTTAACTAAATTCCCGCCAGCATGGCTGATGGCCATTGTTTGTGATCGAGATCCGCGTTATGCAGCGAAGT
CATCGAGAGCTCTGTCAAAGATGCTTAGAAGCGAGATTAAACATGCGCATCGTTGACTATTTAAAACATATGATCAGACTGGACACGTTAATTGCGT