Description :
From Genome Similarity Track
Location :
Scaffold_434:929- 5129
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_434-snap-gene-0.6Notchless family protein
Pytve_DAOMBR484maker-pve_contig_434-fgenesh-gene-0.2Serine protease family S10

Sequence
4200 bases(100 bases per row)
CGCCAAGAAGCAGAAGCTGGCGGACGCGGCGGCGGCCGTCAAGGAGGAGCCGGTGAAGCAGGAGCCGCGTGTGGACGACAGCGAGGATGAGGAGGACGAG
GACGACACCCCCATGTCGGTCATCGCGCAGTTCCAGAGCGAGGATGTGCGTCGATAGTTGATGGCATGGGTGGATTTGATGGCATTGGCGACTGACGTCT
TGGCTGTTTGCACGCAGGGCACGAGCGTCGGGCCGCAGCTCGACCTGCCTCTCGGCTCGAACGTCAAGCAGATGGAGGAGCTCGTGAACGAGCTGCTGCA
GGTCGGTTGTGTTTGGCTGGCGAGTGCTGGTGGAGTTAATGGTGACGTATACTGCACTGCTTGTGACTGTTGCACAGAACGGCAAGAAGAAGGTGCCGTA
CTCGCTTTTCCTGGGCGAGACGGAGATCACGACGTCGCTGCGCGCGACGGTCGAGGAGCTCAAGCTGACGACCGAGTCGGCGCTGACGATCACGTTCCAG
CCGCTCGCCGTGTTCCGCGTGCGGCCCGTGACGCGCTGCTCGGACACGCTGCAGGGCCACTCGGACGCGATCCTGCACGTGAGCTTCAGTCCGGACGGCA
AGCGGCTCGCGAGCGGCGGCGGCGACGCAACCGTGCGCTTCTGGGACACCAACACGTGCCTGCCGAAGCACACGGGCCGCGGCCACAAGCACCACGTGCT
GTGCACGGCGTGGTCGCCCGACGGCGAGCGGTTCGCGTCGGCGGACCGCAACGGCGAGATCCGGCTGTGGAACCCGCAGACTGGCGCGTGCGTCGGCCAG
CCGCTGCGCGGGCACAAGCAGTGGGTCAACTCGCTCTCGTGGGAGCCGCTGCACCGCGATGCGAGCGCCGAGCGGTTCGCGAGCGGCTCCAAGGATGGCA
CGATCAAGGTGTGGAACGCGCGCACGGGTCGGCAGCTCGCGTCGCTATCGGGCCACACGGACTCGGTCGAGTGCGTCAAGTGGGGCGGCGAGGGCTTGCT
GTACTCGGCGTCGCGGGACCGCACGATCAAGGTGTGGGCGATGGAGGGCGGCGACCTGGGCAAGCTCGTGCGCACGCTCGTGGGCCACGGCCACCGCATC
AACTCGCTCGCGCTCAACGTCGACTACGTGTGCCGCACGGGTCCGTTCGACCACACGGCGACGGCGTTCACGAGCCGCGAGGCCATGCAGGCCAAGGCGC
GCGAGCGGTACGACGCCGTGCGTCGCGCACAGCCCGAGCGACTTGTGTCGGGCTCGGACGACTTCACGCTCTTCCTGTGGGAGCCGGCCGAGTCCAAGAA
GCCGCTCGCGCGGCTCACGGGCCACCAGCAGCCGGTGAACCACCTGTGCTTCTCGCCCGACGGCCGCTTCTTCGCCAGCGCCTCGTTCGACAAGAAGGTC
AAGATCTGGAACGGCGCGACCGGGCAGTTCGTCGCCACGCTCACGGGCCACGTCGGCGCCGTCTACCAGGTGTGCTGGTCGAGCGACTCGCGGCTGATTG
TGAGCGCCAGCAAGGACTCGACGGTCAAGGTGTGGGAGCTCGCGAACCCCAAGAACGCCAAGGCGACGCTCTCGGGCCACGCCGACGAGGTGTACGCGCT
AGACTGGAGCCCGAACGGCGACAAGGTCGCCTCTGGCAGCAAGGACCGCACCATCAAGATGTGGGTTTGGCTTTGTGATGATGCGTACTTACCGGTTGAC
TGACTTTTGCTTGTGTTTTTGCTTTGCAGCTGGAAGCACTGAGCTGCGAGATGAAGCCTATACATTTCTTCATAGAGTTAGACCGCGTTAAGTTTTGGCG
CTGAACACTGCGAACTTTGTGTATCCTCCTCTCCTTCCCGCCTTTGCCTTTCCGCCAGGAAATGCGCGCCACAATCGAAAAGCGCGCGGGACTCGAGGCG
ACTGATTGGCTCGACTCGGCGAACGATGAAGCGCGCTCGCGAGTCCGACGAAGCCGGCGGCGTGGCCGTCTGGATGACGCCGCCGCCCGCGCGCGGTCTG
AGCCACCAGCACCACTGGTCCGCTCCCGCCCACGGCGGCGAGGCGAGCATTTCTCCCTGGAAGCAGCAGCACGGCCACGCGACGTTCAAGCGCTGCCGAG
ACCGCTCCGTGCCCATGGGTATGTTGGCGCTAGGCCGGTTGGCTCCGTATCCGGTTCGGTGCTGACGCAGTGAGGTTCCTACTGGCAGACGCGATGAGCC
GGATGATGTCGGCGGCCGTCACGAGCGCGCGCATGAAGAAGCACGTGGTGGCGATGCTGTTCGGCCAGGCGACTCCGTCCGAGGCGCCAAAGCAAGCGAC
CTGCTGCGCGGTCTGTACGCAGAACGGGGCGGCGCGACGGGAGCCAGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGTGCTCGCACTGCGA
GCGCGCAGTCGGCGAGTGCTGCCGCCGCGAGTGCGAGGCGTGCAGCGGCGTCTTTTGCTCGCTCTGCTCGACGCTCAAGTACGTGGTGACTCTGTATGAG
TGTGTGTGTGGTATGGGGCGGTAGCTAATGTGGTGTGTGATGGTGCCTGCAGCTGCGACGAGCAGTTCGACCGCGTCTTCTGCCTGTCGTGCAACTACGA
GCTCGCGCACTCCTGATCTCGAGACCGCTCGTCGCGAGCTCACCCACTGCCGCCTCGGTCGCCAGTTCTGCAATCGTCGTCGGTTAGAGCCATGTGCGTT
GGAGTGTAGCATTTTCTTTTAGTAGTAGTAATATGGGTGAATCGATTCCCTCTTGTGCACGTTCGTGAAGCCTTGAGCAAGTGCGATCGCAGCGAACATC
TACGTGAAGATGGCCGGTGATGCTGCCTCCTGGTCGAACAGGAAGCGGCGAACCATGTCGAACGCCACGGCAGGTTGGTCGTGCGGCACCATCTGCACAA
GCAATCTTCAATCTCCCCACATTTGCTATCTACGGCATTACAAAACGACACGTACATGACCCGCCTCGAAGATCTTGTAGAACGTGAGACCATGGGAGGA
TCGAACTTGTCCGACTGACCGGTTCTCTGGGCGATAGTCGGACAGCGGAGCAGCCTGGAACTCGTCTCGGTGAGTCCATTGCAAGCTGCGCGTCCATTTG
TCTTGAGACTGCCAGTTGACGACCGTGTCAGCGTCGCCGCCGTACACGAGCACGCGGACGCCTCGTTCGAGCACGAACGCCACGTTGCTCTCGGACTCTG
CGATGGCGTCCACCGCATCCAACCCATCTCCGGCATTCATGGCGCACAGCTCCCACTGCTGGTCCGACTCGCCAAAGTATTCCAGCGCGCTATCAGAGTT
GACGAATTCTTCAACCCGCGAGAACCGATAGCACAAACCGAGCGGGTCGTCGCGACACGGACGACGCATGTCGTACACGTTCCAGCCGTGGCTGGTGACA
GCCATACTCGCCCAATTCCGTAGGCGTTCATAGTCGTCGGCTGCCGTGACACAGTCGTCTGGTATTTGAATCGACGCTCTGCCCTTCCGGCCATCGTCCG
CATCTGCTACCAGGAGGAGTTGGCGCTGGCATTCCGCCATGGATGCACTGAACGTGGTGTGAGCAGCCTTGATTTCTGCTTTGAACTGCCCAAGCAAGTC
TTTGCCGTAGCTATTTGTTGTCGCGAACGGGATAAACGCATCTGCAACCGCGGTCGACGACACCACACCATTCCCAATGCCGATTCCTTTCAGCGTTCGG
CTCCATCGGGGATCTGCATCTTCGTCCAGCAACTTCGCGGCGAGGTCCGGAACGTAGTGGCCGGCAAAGCTTTCGCCAAACACATAAAAGTCGTTGTCGA
TCAGCTCGGGATGGCCGGCAAAGAACAGCTTCAGGAAGTGCTCGAGGTCATGGGTTGCCTTGCCTTCAGTCCACGCTGCCATGAGCTCCAAATGATCATC
ACTGAAGCCAGTGCCCAGCGGCTGGTCGACGTATATCACATGCGCGAGCGACGTCCATGCGTACGGATTGACCGACACGTTGCGAGTTTCGTCGTCGAAC
ATGCAGGGACCATTTTCGAACAGCAAGGCGATGACACCAGAGCAGCCTGGTCCACCAGAAAGCCAAAGAATCACTGGAATCGACTCGTTCGTCTCTTGAG
CAGCTTGTTTATCGGCGTCATCGACCGACGCCTGATAAAAGACGTAGTATAATCCGTTGAGCGTGCCGGTCTCTTTATCCAGATCCTCGCCACAAAGCGA