Description :
From Genome Similarity Track
Location :
Scaffold_1266:929- 2541
Sequence
1612 bases(100 bases per row)
AGTCAATTCAATGTCCAAAAGCTTGTCGTGCTCGAGCTTGACCATTCCATAATTCGCTGTCTCAAACGCACTCCTCGTGATCCCAGCACCAGCAGACGGA
GGCATGAAGGACCTCGAGGTCGGGACGCCAGTGTACGATGCGCACGCCTCGCCAAAGCCACCGTCGGAACTGGGCGTCGACAAGCCGACGGCCAACTCAC
CGTCGATCTGGCTGCTGCTCGCTGTGTCGCTTCCCCGCATGGCCATCAACATGGCCTGGTCGGCGCAGTGGGCCGCGCTGGGTCCGTATCTGCAGACGAT
GCTGCCGAGCTTTGCGGTGCAACTCACGCAGATCATCGGGCCGGTGGCCGGCATCCTCGTCGGTCCGACCATCGGCGTCTTCAGCGACCGCAGCACCAAC
AAGTTCGGCCGCCGCCGCCCGTTCCTGGTCACGGCGGCCGTCACGAGCATCATCTGCTGGATCCTCATGGGGTACACGCGCGAGATCGGCGACGCGCTCG
GCGATGTCGGCTCGGGTGCCGCGGGCGAAGTCACGCACCGCACGTGGACGGCCGTGTTCACCGTCATCTTCTACATCTGGATGGACGTGACGGTCAACAT
CGTGCAGACTCCCGCGTACCTGCTGATTGCCGACTTTGCCGGCGACCGGCAGACGCTGGGTGCTGCGCTGGGCCAGGGCTGGTCCACGCTCGGGTCGATC
CTCGTGGCGCTCTACATCGACATCTTCGGCGCCGCGTACAACACAATGCACTGGTTCATGGGGATGCTCTCGGTCGTCATGCTCATCTGCGTGGGTATTG
CGAGCGCCGTGGCCAGGGAGACGCCACTGGACCCTGCCAAGGTGGACGGCAAGTCGACGTGCGAAAGCGTCGCGCACGCCTTCGGGTCCATCTACCACGG
CATCAGGACGCTGCCGAGCGTGCTGGTCGTCTACGCGCTCGTCATCGTCTTCCTCGAGTACGGCTACACGGCCTACAACGGCAGCAAGGGCCAGTTCTTC
GGCCTCGAGGTCTACGGCGGTTCGTCCGAGAACGCCGACACTTGCGACCCGTGCTCCGAGGCGCAGCAGGCCTACACGCACGGCGTGGGCATCGCCGGCG
GCCGCGCCGACCTGCTCTTCAACATCATGGGCTACGTCTACTCGTGGACGCTGCCCTTCCTCGTGCGCAAGTTCGGTGCCAAGTGGGTGCTCACGCTCTC
GTGCATCCCGCAGATGCTGCTGCTCGGCATGGCCTGGAGTCGCAACGTGAGCTTCGACGTCTTCGTCGTGGCCATCACGGGCATCTCGCAGACCGCCATA
TTCGCGCTGCTCGTGCCCACCATCATCCACGTCTTCGGCGACCAGATCGACATTGGCGTCTACGTCGGCGCGCTCAACTCGGCCAACTGCCTCGGCCAAC
TGCTCGAGTTCGCCATGGCCACGGCCATCGTCGGCTCGCCGCTCGGCTACAAGCTCCCCGTCTTCCTCGGCGGCGTCACGAGCCTCGTGGGCTTCCTCAT
CTGCCTCTTCTTCCTCAAGCTCAACATGCACGCCATGTAGACCGCCACAATTCCATCAACGCACAGGGTCAGGTGGTATTTGTTTGAGGTTTTGGTAGCG
AACAACAGTGCG