Description :
From Genome Similarity Track
Location :
Scaffold_405:928826- 931278
Transcript NameFunction/comments
Aphin_H310_03943beta tubulin
Aphin_H310_03944Hypothetical protein
Aphin_H310_03945PREDICTED: acyl-protein thioesterase 1-like

Sequence
2452 bases(100 bases per row)
TTTCGGAGGTTTGCACGGGGTGGCGCTTTCGAAAATGAGCTCCCCTGACGAGTCACAGGCTTTTCCCCACCCCTGGTGGATGAAACAGTCCTAGCCCCTC
CTTCCAACCCCCCTTGTATTGACCCTCCGTAGAGGAATTTCAACTTGGTTTTTGTATGAAACACTAGGGTCAAGGAGGGGGTATCGATATACCCCACCCC
CATTGTAACGAAAGATCTTGGGGTATTTATATCGTTTGTGGAAAAAACACTCGCCCCAAATTCAAATTTTGAAACCGATTGAGAGGGAGCCAATCAGAGA
CATCCATTCTCGAGAGGGGTTGGGTGGAACGAATTTATAACCAATCAACACGCGAGTTGTTTTTAAATGTGTCGAAAACGAAAAAAACCATCCATGGAGC
GCGCGCGGCTCGGTAGTGTTTCGACGGCGAGGCGGCAGCGTCCGTGTATTTATAGGAACCCCCCGTCATGAAACGTTCCCAGGCGCTTCTCAATAAGAAG
CGTTGAGGCTGTATGGAACGTCAAGATGGTGCCTCTTGTCGTCTTAGCCATCGATCGCCGTCTGTCGATCGAAACGGCGCGCCACATCGTGCCAATGGGT
TGGGCAACGTCAAGCGACGCATTGGACCTGATGTTGATGGAGGAATACGTCCGCCGATCCTGGGGGCGAGAGTCAGCAGTGCCCCGAAATGGAAGAACGG
TCAGGCGGTTGCCATCTCGCTGCTACAATGGAATCCATGGACACCACGAAAAGGCTTGCGTGACTGTCGCCGTGACGTCCTTGAGTTCGTTCGGCGAGAA
GCATGTGGACATGGGACGTGCGCGACAATCGCGCCGCCGCATGTTCGGCATTGACGCTCGCCGATGGTGCTTGGGGGAATGACTTGATCCACTATTGGTA
CTTCATGGAGATGCGGAAATACCTCGTGGAAAACCCAGAAAATACCATGACGTTCTTCAAGGCGATTGACATGGAACGAAAATGTTAAATACCTGACCAA
AAAAGGGCAATATTCGCGAAATTTGTCATCATTTTTATTCGATATGGCGAAAACTAGTTGAACCCAATCTCCCAAAATCACGTGGAATCATAAAAACGCC
GCCATCGGGTTGCACCGCCACGGCAGCACCAATACCGCGTTCCGCGAGCGCATCGGGATGGGCAACTTCTGCGCCCCGACGCTGTGCAATGACCTCACCA
TTGCAGAGTGGCAGCATGCAACTATTGCGCCGTCGGCAAGACATGTTGCAACTGTCATCTGGCTCCATGGACTTGGCGACTCGGGGCTGTCCTGGTACAA
GTGCGTAATCGAGGCCAAGCCTTTGCCACACGTCAAGTACATCTTCCCGTCAGCTCCGTTCCGGTCCGTGACTCTAAATGGTGGTATGGCGATGCCAGCT
TGGTTTGACATATATGGCCTTCGCCCCGAGGTAGACAATCATCCAGCATGCCATGGAGAACTGACGTGACCGACATAGGACAAAGAAGACGAGGCTGGAA
TCAATCGATCGAGCGTCTTTCTCGCTCAAATCATTGCAAGAGAGATCAAGCAGGGCATTTCGCCCAACAACATCGCGGTCGTTGGGTTCAGCCAAGGAGG
GGCGTTGGCTGCCCATACGTGCTTCCGAACGTTGACCTACCAGCTTGGAGCGGTTGTCCTCCTCAGCAGCTACGTCCCGCTGGCAACTTCGTTCGCCCCA
AGCAATAACAACACGCCAACACTCGTCTGCCACGGCGACCGAGACATGTTGATCCCTGCAATGTACGCCCACAAATCAGTTGAGCTCCTGAAGTCGCACC
GGGTTCCCACCGAACTCAAGCTGTACAGAGGCCTCGCACACGCCTCCAATACAAGCGAGATGGCCGATGTATGCCAATTTCTAGCCCGTCACCTCAACGT
GTCTTTGCCGAGCCATGTGTAGACCATGTATGCGACAGTGTATAGATGATACCTGTAATGACCAAGTCCTATTTACTAGATCAGCTAGGACATCGGAAAA
CTACGCAAGTGTGATGAAGGAGAACTTTGTCAGCACTTCCTCCCTACCGACAATGGACTGTGAGGCGCATTCCTACAGTGACCGCACAAGGGATGCAGAG
CAATACGTTGGCGGCACCAACATTTTCGAGACTTCGATGTGAGCGAATTCGACCGCAGGGAACCCCATCCATTCCTTCGCTTCCAGTCTACGTCGGTCCC
ATGCCACCGAGCAAAGCCACCACCCATCCAGAAATTACACAGTTCGGTCTACGTGGGGTAGTTCCTGCGCGGCGAACGGCGTTAGGCACAGTGGTAACCT
TGCAGTGCGATTCGCGGTCGCTACATGTGAAATGGATCAACTCCGAGCATTGACGGCCGTGGCTTCATTTGGTGAAAACACAAAGCCATAACACGCTTAA
ACTAGTGCAACGAAAGTTGTCGCATGTGTGGCGGTGACCAAACATATCGGTC