Description :
From Genome Similarity Track
Location :
Scaffold_403:9286- 13282
Sequence
3996 bases(100 bases per row)
GAGGAGCGGCAGTCGCGTCAGATGCGGTCGTTCCTGCAGAACTTTCTGTCGGACGATCGCGGTCATTTCCACGATGTGCTCGACCTCTGTCAGCACGCCC
TGGACACGGGCATCACAGTGACTGACGCGACAATCCAGGAGGTCGTCAACACTGTGCCGGCGGTCAAGGGCCTGCGTCTCACGGGCTGCTCGGCCATTAC
CGACGCCGGCATCTGGGCGATCGCGAGGCAGTGCACGCAGCTCGATACGATCTACTTGGCTGGCTGCGAGCGCGTGACGGATCTCGGGCTGCGGCTGCTC
GCCCACAACTGCCGCTTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTAAGCGACTGCCCGCAAGTCACGGACGCCATTCT
CCAGACGCTGGCTGCCGGTTGCTGGATGCTGCAGACGTTCATTCTGCAGCGGAGCCGCCGCGTGAGCGACGCAGGCATCGTCAAGATCGCGCAGTGCTGC
AAGGATCTGCGATATCTCGACTTTTCCGAGTGCGAGCACGTGGGCGAGTACGGCGACAAGGCGCTGCTCGAAATCGGCAGGTACTGCTCCCAGTTGCGTG
TGCTCGACTTGTTTGGCTGTCGCCACGTCCAAGACACAGGTGTACAAGCCATCGCGAGAGGGTGTCCTCGGCTCACGACGCTCAAGCTCACGGGCTGCCA
GGGCGTGAGCAGCGTCGCAGTGCGGGCGCTTGCCAGACAGTGTCCGCTGCTCGAAATCCTGTCGCTCGCTGGCTGCATCAAGACGACGAATGACGACGTC
GCTGAGCTTGCACGCAACTGCTCTCGTCTCCATTGGCTCGACATCAGTGGCAGTCCGAGCATCGACGCCACGGGCATTCACGCACTGGCGTTGTATTGCC
ACCACCTCACGTACCTCAACCTCTCGCATTGCCGGCGCCTCAACGATGCCGCACTATTGGAGCTCGCCGGGGAGAAGACATGCTCGCGTACGATGCTGAC
TCATCTCTCTATCGCAAACTGCCCGCGCATCACGGAACGCGGCGTGGAGCTGCTGACCAACGCGTGTCCGAATCTGCTCACGATGGACATGACCGAGTGT
GACCAAGTCGGGCGACGCTTCCTCCAGAAACTCGTCCAGAAACTCGAGTTTGTCGAGTGGGCCAGCACATTCTTTGGCTTTCAGCCATTGCCCAATGCCG
CCGAGCTGTGTCGCGCTCGGGATCGCCGTCTCCTCGAGCAGAAAAGCGCGACCAAGCTGCAGGCGCTGATGCGCGGTTGCCTCGCGCGTGGCGGTGTGTG
GCAGGCCAAGCTGCGCTACGTGGAACGCAAGTGGCTGCCACGCATCCAGGCGCATATCCGAGGCTTCCTCGTGCGCAAGCGACTCGCCGCGGAAGCGTAC
GACCGCAGGAAGCGCGCGGCTGCGCTGTTCATACTCGAAACGTATCGCAATTGGCGCCTGCGTCGCCTGCTCGCACGCCATCGCCGCGTGCTACGGATCC
GCCGGAACGAAGAAGCTGCTGCCGTCATCTTCCAGAAGGTTTTCCGTGGCCACCGTGATCGCAAGAAAGTTCAGGCGATGCGAGACGATATCCAGCGGCA
CCGGCAGCTCGACGCACGCATCCACGCGATGCTCGAGTTGGCCGCAATCAAAGTGCAGCGCGCGTACAGGGGCCATGTCGGCCGTGCGGATGCGTCCATA
GTTCGTGCTGCACGAGACGCCCAGCGACGCCAGCAGGAAAAGGAAGTGACGGCGGCCCAGTTTCTTCAGCGTGTCTACCGTGGCCACCAGGGCCGCCGCC
GTCGCGCCGCTCGACTCGCCGAGCTGCTTCACGAAAAGCAGCAACACGCCGGTGCCGTGAAACTGCAAAAGGTGTTTCGAGGCCAAAAGGGACGCCGCAA
CGCACTGCGTATGAGACTCCACGTCGAGCAACTGAGACGCATCGACGCGGCCATGACGATCCAGCGCCACTGGCGCGGACTCAAGGACAAGCACCTCGCC
GCGGTGCTGATTGGACTGGTCAAGCTGCGTGCGCGAGAACACACGGCCGCTCATACCATCCAGCGAGCGTACCGCATGTACGCGTCACGAGGGTTCCTCA
AGGCCATGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGCGCAGCAGCTGCAGAGGCGAAGACTTTGCGGGGCCATGACCATCCAGCGCATG
GTGCGAGGCCACCGCGGGCGAGCGAATGCTGAAGTCCAACGTGAGCTCCGCAAACTGGAAGTGGTCGCCCAGCCGCTCTTTCGGAAACGGGACCGTCTCC
AGAGTGTCGTCAACGACCTCGCAGCCAAGGTCCAGAGTCTGCAGCACGAAATCGAGAGCGACGAGCGAGACGAGGCGTTGCTCGCACTCGAGCTGGAAAA
GACCATGCAGATCAAGACCAAGTACCACGACTCGAGCCGCATCACGGGCACGCCGCAGCGGTATCTCACGCAGTACCTTCAAGTGCAGCTGGCCGACCAG
CTCCGAGCCAAGCGCGTGGAGCTCGCGATGGAGACTCGCTCGCTAGAGGTAGTCGAGACGCAGTGGAGCGACGCGCAGAAGCAGCTGCGGGCGGTCACAC
GAGAGCTCGAGCCGCTCACGGTCGGCGTGATCGCGCAGACCAATGCTAACCGCGTCCAGCGGCTGCAGACCAAGGTGCGTCGCGAGCGCGTCGCAGCCAC
GCTGATCCAGAAGATCTTTCGAGGGTTCCGCATTCGTTGTGCCGTCCGCGAAGGCGCAAACTGCTGGCTGGAGCTGCCCGTGCCAGAGGAGCAGGCAGCG
AGCGGACGCACAGTGTACTACTATAACGCCTTCACAGGCGAGTCGCGGTGGCGCAAGCCCCTGGCCATGAGTATCTTCCACGATGGGTTTCTAAAGCCGT
TGCCCGTGGACCGCGCGACCACGTCGAGTGGCTCCACCACGACAAACTGGTACGAAGCCTATGACGAACGCGTGGGGCAGCGATATTACTACAACCCTCT
CACGAAAGAGTACCAGTGGGAGAGGCCCGACTCGCTCTCGCCTGACTCGGCGTACCTCACCGACTCGCAGTCCTCCCGCAAGCGCCGTGAGTGGCTACGA
GATCAACAGGATGACGGCGACCTGGAGCTGTTGATTGCAGGCTCACAGCTGCGGAGTCAGCTCGGCGAGTGGGAACACCGCGTCGATCCACTCAGTGAGT
GTTGGTTTTTCTACCACCCGCCCACGGCGGAATTGCGCGTCTCACTGTCGCCGAGATCGGTCCACCACACCATCGCTGGTGTTGTCTCCACGTCGTCGTC
CAGAAGATCCGCTCGCAGTGTGACAACGACGTCACCGCGACCCATGCTGTGGCAGTATCGCTACAGGTACGAGGTCGATCCGCAGGGCGATCTCGTACGT
GTGAACAGCCAAATCGACGACGGCGTCGAGCGTCCGATCTGGACAGAGCACATGGATGAGACGAGCGGTGTTGTCCCGTACTATTACAACCACATCACGC
AAGAGTACCGGTGGGAAAAGCCCGCCGAATTTGGGCTCGGCTTTGAGGCCTATGCGAGCACGACAAACTCGTCTCGCGAGTGGTTCCGATCCCAACAACA
GCAACAACAGGAAGAGATTGCAGCATCCACCGCTGGCTCGTCGGGTCGCTCCACTCAGCAGCTCTTGACGGAGCGGTCCCAGAAAGTGCGAGCGCTTGGG
AGAAAGTGGGTCGAATGCATGGATCCAGAGAGCGGCAACTCGTACTATTACAATGAGATTTCGGGCGAGACGCGGTGGTCGTTGTCCCCACGGAGTGCTC
GCGACGACGTCGATCTCCCGGGGGAGATCCCCATGCAGTTGTACGAGCAGGTCAAACAGCTCCGTGAAGCTCCCATCATGTATACCGCACGGGACACGCA
CATGTCGTGGCTGGACGACGCCATGGACAACAGGGACTGGACGAAAGTGGATGTGCTCGTCCAGCAAATTGGGATCCGCGAGCAAAGCAAGGCGGT