Description :
From Genome Similarity Track
Location :
contig_7:928465- 937802
Transcript NameFunction/comments
g2173.t1hypothetical protein AM587_10008063
g2174.t1CAMK protein kinase

Sequence
9337 bases(100 bases per row)
CGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGATCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGC
TGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGC
CACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGCGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGAT
ACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGC
AGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCAT
CTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCC
GCGCCTGCTGGTCCTTTAGTTTTTTGATTGCCCGTGCGATACAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAG
TGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGAC
CTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAAT
TGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCA
ATCGGGTTGGTCACGATGTTCGAGACCAGGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCG
ATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTA
CGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCG
ACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGTGTGGCCGATGGCGACACCGAAGT
TCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCT
TCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGC
TACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTA
CCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTTATTTACTTAAGTTCAGTATACTT
GTATCCACAAGTATACTTAAACCAAGATAAATGAACCAAACGAAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAAC
TGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCAT
ATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTGTGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCC
CCGCTACAAATTGCCTGTGGCTCTACCTGCATCAAGCCTCCCACTCGCTTGGCCGCCTCGGGCGCAACAAGTCTCCGGTAGCAACCTCACTGACACCTCT
CGCCTTGTGCGTCCCACATCATCAGTGAACGCAACAATGTACTCTGTGTCGCCATGTGTTGGAAAGCCCCCCTCACTTATTATCTCTCCTTTTTATTCGT
CTCATCTTCTCCTCCACCGATCCAGTGCAGGTGAAGGTCAGTCCTTCCACCGACCACCGCGTTCTCACTTCGTTGCTGCGCTTGATCTCCTTCCGCAGTT
CCTGGACTGCCTGAGGGTTGTAGTTTCCTCCCGCCTGTGGGCCTGCAAATAAATAAGCCGTCCATGGGCTGGGATAGTCACTTCCTCCTCGCAGGTAGAG
CGGTCACACGCTGGGACTGGGCCACGGTCTCTTGAAGGCTGCAATATCAAGACGAGGGTGTCAATTTTCTCTTCAAGAGCTTTCATCGAGGTTTCGACAG
TCTTCAGACGCTTTTGAATTGAGCTGTCGGATGATGCCTTGAAAGGACAGCAGCGTTTCGTATCCGCCCCATATACGTCGTTGGATACCCTGAATGGACT
TCACAATCTGGTGATGAACTTTGAATCACATTCTGATTGACGTATATTGACGAAATATGTCGATGTGACTGGCCCTGCAATCCGGTTTTGCATATTTTAT
TGAATCAGACAAAGGGAAGTTGCTTCCGACACCGTTTCAATACAAACCTCAAGTAGGTCGGAAGCATCTTCAAATTTCTATGGTTTGCAAAGCAATTTGG
TCAGGGTTAGGTGAATCCTTACAAACACAAGATTCTTTTATAAACCTAACCCTTCGTTTTTGCGAATGTAAGTGCTACTTCTTGGCACGTTAATTTCTTG
AACCGCGTTGGACAAGATTCCCCGGAGGATTTGCAGCGTTGAGACGCATTCTTGTTTTTTTACATCTCATTCCATGCCATGTTGAAGCTAACTCGTCTTC
TCCACGTTCGACATGGACCATTGCTCAGTGCAAAAGATCATTATTTGCTGTAGTAGATCGAGGAAGCAGAATTGTGAATTTCTGGTACGAAATGTCCCCG
CCGGATCGCCACAACTCCTTCCAAGAGCGGCGTCCTCGCCGTTCTTCACCGTTCTGCTCCATGAGGCGACTGAACAATGTTGGTTATTGAAAAGGCAGCG
CATTCGGCTTATTTTTTTTATATTCAGAGTTGGTTTCGCGCTGTTTTAAAGTAGAAAACCCCGTTGGAAGCCGATCTCACTGGTGATAGCTGCCTTTCTT
TTAAATGAGTGCGTCATTTATACTTGCAGTGTTCATTTACGTTTTGGTTAGTGATGTGTCCCGAATTCCGACAGTACCAGTAACGTTAGCAGGATTCTGT
TACCCAGCCTACGCCCAAAAACCATTTACTAGGGCTTAACCCTATAAAACCGAACTATACGTGGCCATGGTTGGACCTGGACTTACGTCCGCGAGCAGTG
CGTATTTCGCAGGCATTCTTTCAGCTTGAGCGCGGAAGTTGCCTTCACCCCCTCCTTTTGGATCGTTTATCAGAGTATTCTGGTGCCTTCGCTTTATCGC
CTAATTCAACAGGACAAACTATTGATATTCGGTTTTCACAATAACTGGTGTTGGTTCAGTGAATACGACTACAAGTTCTGGTGGTTGACGATCGCTGCCA
TGACTTTTTGAGTCCAGTCGGCGAGTTCTTGGTGCGAGTGGGCCAGTCTCTCGAGTTGCTGGGATCGGATCTCCAGCAGCCGCAGGATCTCGTCCTGCCT
CGGGAATTCTTCGTCTTCAGCTGGTGGAGAAGACGCGCTTTGTGACGTCGAGGAGATCGTCTGTGGGGACAACGAAACTGGTTCAGGAGACAGCGGGGCT
TCAACCTGCGGAGACGCTGGAGGAGACGAAGATGCCTCCGTCGTCTCTCCTCTTAGGAGACGTCTCGCCCCCCACCTTCTCTGCGTCTTGCACCATGGCC
TCCTCCGCTGCTCTATTGAGAGTGCTCCTAGCTGATTGTGACGTCGCCACCGTCGTGCTCTGGCTGAAACACTCGGCCATCATCAGGTGCAGCTGCGCCG
CGCTGCTGTCCTGCCACTGCTTGCGCAGCTTCGTGAGCTGGTCGCTGCACGTGACGGCGTCCGCCTGCAGGCCCAGAGATTCGTTCTCGTTGATCGCAGT
CGCCACGATGCCCCAAGCCTCGTGCACGTCCGCCACCGTCTGTGCCTCGTCGAACAGCCCGCGCAGCTTCCGGAAGCGCAGCCGCAGCAGCTCCCGACTC
GCGCCCGCGCTCCACACCGCCTCCTGCCGCAAGCGCTTCGCCGGGCGGTGGATATTCGCCGCGTCGTCCTTCGCCATGAGCGCTCTTCAGATGGTCCACC
TGAATTTTGGACCAATATCCACCGTTACAGTCACAACGTTCCGCCCTTAACCAACTACTGGAACACCTCTCACTTCCAGCACCTCTATAATCGTATCTTC
GCAAAATCACAGTCAACGCCCTTTCTCTTGTCAGATATGATCCCCTTGCATTATCGCTATGGTCCGCCCTACACATATTTACCTAGCAGCACTGTATCCC
GAACATGTCGCTCCATCCGAGCTATCATTATCGTTTCCGCCACCAATAGCGCAACCGCTGAAAATGGACCGGTCGCAGTGGAAGCGCGTGGATGTCGTCG
TGCCGCTGGCCCGCTGGGACTCATCGTGAGCAAGGCCCCCTCAGGCGAGGGCCACGTGATCGTGGATGGCTTCCGCCCTGTGGGCGCGGGCGCGGCCGGC
GCGCTGGAGCAGCAGGGCGAGGTGCGATCTCAGTCGCTGCTGCTGGGCGTCAATGCGCACGACTTCACGGACGCGGCGGCCGCCTGGAGCTTCGAGAAGA
TCCGCGAGATCCTCGTGAGCACCAGCGGTGCCGAGCGCGTCGTCTTCCTCGTGCCCCCGCCCCCGGCCGTGCAGTCGTGCTGGGGATACACGACGCCGCG
CGCCGCTTCGACGACTACGCGCTGGGCCGAGAGCTCGGCTCGGGCACGTTCTCAGTGGTTAGGGAGGCCACGCACAAGACGACGGGCGAGCGCTTCGCCA
TCAAGTGCATCAAGCGCGCGCAGCTGTCGACCGACGACCTGCGCCGCGCTCGTGGCCGAGGTGAAGATCCTGCGGGAGATGCAGCACCCGCACATTGTCA
AACTCTACGACGTGTTCCAGGAGGAGAAGTACTTTTTCCTAGTGACCGAGTACATGCCTGGAGGGGAGCTCTTTGAAAGGATCGTCAAGAAGAACTTTTA
CTCGAGAGAGAGGCCAGAGACTCGTCAAGGTGCTACTGGAGACCATTGCCTTCTGTCATAACGCTGTGGTGCACAGAGATCTCAAGCCCGAGAACCTGCT
GTTGAGCAGCGCCGAGGACGACGCTGACATCAAACTGGCCGACTTTGGGTTCGCCAAAATCGGCCATCCAGAACGGAGACGCAGGACTCGTCACGGCCTG
TGGCACGCCGGGTATGTGGCGCCCGAGATCTTGATGTCCAAGCCGTACGGGAAGGAGGTGGACATCTGGAGCATCGGCGTCATCACGTACATTTTGCTCT
GCGGGTACCCGCCCTTCCACCACGACAACCAGGGCGTGCTCTTCCGACTCATCAAGGCCGGACGCTACGAGTTCGACTCGCCCTACTGGGACGACGTCTC
GACGGAGGCCAAAGACCTCATCAACAAGATGCTCGTGCTCAAGCCTGCGGACCGCTGGTCGGCGCGGCAGCTGTTGGAGCACCCGTGGATCGCTGGAGAC
GCAGTCAAGGACGTGCAGCTCACCACGGCGTTGCAGGAGCTGCGCAAGTTTAACGCGCGTCGGAAATTCCGTGCTGCGGTTAGCACCGTCAAGGCCACGA
TTTCGCTCACGAAAGCGCTAACGCTCGGCAGCAGCCCGCGCAGCAACAAGGACAGCGGCGATGAAGGCGACAAGGACGCTCTGAGTGCACCTGCAGTTGC
CGCGGCAAATGTTTCAGCTGTGCCGCCCCAGCGCCCACAGCTACTCAGTAGATAGGACCCAGAGATCGTTTCACATTTTCGTGGAGAGCAGCACGTAGCA
GGTAGCAGCTATGGACAGCTGCGATGTGCTAGAGCTCGCGCTGTTCTCGCGTGTGGGGCAGTCGAATACATACTACTTCAAGACTTGAAGACACAGTCCA
ACCGCCATTGCTGCGGTAAGAAAACAATGAGCAGGAAAATGAAAGTCACTTGGTCGCGATGAGAGTGTGCGTTTCACGGATGAACGTTGAAGTGGAGCTC
CTGGAAATAGTGCGGATCGGACTGAGGACGAGACAAGGTAAGGTGCTGGTCATGTTCGAGGACAGCACGGTCTGAAAGTGGCGTGTGAAGCTATTGAGCT
AGGTTCACCGGGAGCCTTTCAGCACTTCCAACCCATTTGCCTGTGGACTTTGCTTCTTCGATCTCATTGTGTGATTTTCCAGCTAGGTGGCAAGCGATCG
AGGGTACAAGGCATTCGTCCTTACCATGTTGGCGTTGTTTTCGGCGGTCAAACCTGCAACTTCAGGCAATCAACACTTAATCTCGACGCCTGGCAGTCCG
ACCGGGGAATTCAAAGAGATGTCGAACGGTTTAGTCAAACCCTCCAGCATCGTTATTGCTGGCATGGACATCACGTCGTGGCCGGTTGTCGAGGTCAGCG
TTCCTGCTGGTCCACTCGGAATTTTGCTCGACGGAAGCTGCACCGATGCAGCTTTGCTTGACGATTTTGCTCCCGTAGCTCGAGAAGGCACGCCTGGCGC
CGTGGAAGGAGTGGTAAGGTCCCTCATGGTAGCGTTCTAGTCGGAATGGACAAGTTCGACTTCGTGGAGCAACCGCGGAAAACTCTTGCTGAAGTCGGCG
CCATTCTGCGAGAAGCTGCTCACCTCAAGCGTCAGCTACGATTTCGAGTGCCACCGCAGAACTACCAGAAGCCAGATCCAGCAGCTCATGAGAACGACAA
GTCAAAGCTGTTAACGGGTGCACCAAGTAGCTCAGCGAGCGTTGTGGGGGGCAATGAGACTGGCAAACCTACTGGTGAATGGTCTAGCTGGATGAGGGGT
GGTCTACGAGCTGCAACCACAATTGCTGCTCCAGCGTCTCGTGTAGCACCCCCAAAGCAACAGGTACCACCAGCTTCGCAGCCAACACAAGAGCCGACAG
CGCCGTCACTAGCTGTGCCTCCAGCATTGAAGCCAACAGGTAAACCAGCTTCGTTTGTGCGCGTGACAGGCTTAGAGGACCGCACACTGAAAGCAGACAA
ACATCCATTTGTGCCAACCGCGCACGATAAGGTGGTGAGCATAGAGGTACCACGAGGTTCACTCGGTCTGCACCTTGACGGCAGCGTTGTAAATCGTGCT
GTGGTGCTGGGCTTCATGTCGCTCGCCGATGGCTCTCGCGGCGCACTCGAACGAAGTGGCAGCTTGGCTTCTGGTGCTGAAATTGTGGAGATTAACGGAG
AAGACGTCTCGCAGGAATCTCTAGCTGGAATTCGTGAGCGGTTGGGTCGTAGCAGTGGTGAACCGCGTCGCCTTAGCTTCCGACTGCCACCTCCGATCAA
GCTGGTGGTTCCATTGGTGCCAGACGGTTCCTCGTCGGTAGCAAGTTCGTCAGTAGGCTCGCCACCACCAGCAAGTCGGCGGGTATCCACTGCCAGCATG
CAGCGCATGAACCTTCTCGCGGCTTCCCAGCCCACGTACTCGGAGGACACGGAACTGCGCCGACGTCTCGAGCTGAAGTTGGTCATGAGCTTCGATCGCA
AAGAGATCAAGTACAAAGAGTGCTGGTTTGCAGTTCATACCGAGTGGATGAATCGCTGGGCGCTTTTTGTGGGTAAAGGAGGTCCTGAGCCAGGTCTCAT
AACGAACCACGAGCTATTGGAGCCTGGGTATGCGTCTGGTGAAGACCCGAACCGGGCTGCTTTTGTTCGGCCAGGGCTTGCGATCACTAAGGACTTCCGC
CTTGTGACTCCAATGGTCTGGAGTTTGCTCGTGGCTCTGCATGGAGCAGACAATGCTCCTCCGATTGCAAGGTTTGGACTAAACATCTACTCAGAAGCAC
CTGAAGATATTAACGAGATACTGCATGACGCCAAGCCTCAAGCTGTTGGTCTTGCAACCAGTCTTCGCGAGAAGTGCCAAGTCGAGAACAAGTGAACTAC
TCGCTATATAAACACCACCCCAGCAAAATCAATACTTTAAGTAAATACTTCGAAGTGCATTACAAGCGCTTTCGCGTTATCAATGTCTTGATCTTCTTCG
CTCGCGCACCGATATAGTCGCCACGGGTGCAGGCTCCGAAAATGTCACGTAGGGACTGAAGTACTCCACCTGCCGGCGGATGAAAAGCAGTTGATCTGGA
CTTCCAGTGGCGAGTTCCACCATAACCGAGGAAACCAGCCCAGGATCGTCACTGTGCGCTGCACTGCAAGTATCGAGGTGAAGACGTCGAATCCCGCGCT
GTTTACCACACGCACACTCCAAAGCAGGCGAGACGCAAAAACCTCACCGTTGCCGATAATAAGCTCTAAAGCACAACCTGCCGCGACGGAGAGTACGACA
ATGACTGCAGGTAGACCGAAATGCTTTCGAATGTTGACTTGGCACGCGAAAATCGGTGTGATCGCATCAAGTACCAGCAGACAATGAAACCAGAGCCACC
ATGCGACGACGGCGAGGCTGGACGAAGCTTGCCACTGCAGTAGATCCAAAAGACAGATTGCGAGCGCAGTACCTTGGAAAGTCGAAAAGAGCACATCGAA
ATTCCAGACGAGCAGTCGAAGCAGGTCTCGTTGGGCGACTGCGGCGCACACAGCCACGAACATGACAGAGGATAGAGCTGCTAGCACTGCAATCCCCGTT
TTGAGCCCGTTAATCCGCTCGCTTTGTAGTGCAGAAGCGTTATTATCCAGGAAATTGCGGTGGCGCCGATGCCTACTGCACCCACACAATACAGGGCTGT
TAAAGTGTGTCGAGATGAAAATTTGTGAACAAGATGGCCGGGTAGTAGCGTGTTTCTTGCGTCTACGACATGCGCTTTGGCTGGAGCAAGCTGCAACTGC
TGTACTCGAGACGATTTTGCTGAATTAAACAGCCCAGATCTTGCTTCAGTTGCACAGTTGTTGCTCAGAGTGTCCGATTCGGCGCCGCGTAGGCCAAGTC
GTACCCGCGCCAGTATCAAAACGCAAGGAATAGTGTG