Description :
From Genome Similarity Track
Location :
Scaffold_248:9284- 18112
Transcript NameFunction/comments
Hyaar_Emoy2813169pro-apoptotic serine protease nma111-like protein
Hyaar_Emoy2813170PREDICTED: protease Do-like 7-like

Sequence
8828 bases(100 bases per row)
TTGACATGAAAGCTGACGGCTTGCCGCACGACGGCGCAATTGACTTTTCCAGTTCGTTGTCTTCTGGCCACAACATGGTACATGCAACCCCTATATTTTA
CGGCAATCTTCTTAATCATGACACTTTTTACATTTTGTTTTGGACGCAGCAACCACACGAGTATGGACAGGCACTAAGTCGACTCAACTTCATCGATCGG
TTAATCTCTCGAGATAATCTAAATGTCAATCAACATTTATCTGCCATTACGATCTGTCAAATGTGATCTTCTCCACCCGACAGAGGCAGTGACTACTAAT
GTTACTAATTCATTTTAAACGAGCTTTGATGGTGCTTGTGCAATCTAACTCGCAGCAGTATAATGATCAGAGAACTTTGTAAGGCACCGTGTTGTAGGCC
GGTATTACGCCAGCCTCAAAGCATGCTAGAGATATCTTATTTATGATCGATATCACAGTATGTTTAACTTAGAATGTGATAACTTCGTTGCTTATGCATT
TCATCATGTGGTTATAAAGGCGCAGCTGATTAAGTTAGACAGTCCGACTTGGTGTGTATGCATTAAATAATGGGTGTGTAGCTATAATTCTCCTAAAACA
ATTGACCCTGGGCCGCGATGCAAACCGCGGCACAATATCTGTTAGGGGAAGAGGTACTTCCGTGGTCGCGATGCAAACCGCGGCACAATATCTGTGGAAG
AGGTACTTCCGTGGTATTGTTTGGTATCGGAAGAAGGCAAGACCTGTAACTAGGTGCTCATTGGTCATAGCACTGCTCGGCACGATTAATTTACTTATTT
CAGGTTTCATCACTGACATGGTTTGCCAGTGAATCAATAGAAACCGCACGAGCACACACTCACGAAGAACTTGCTGAAACCAATCTGAATCGAGGATAGC
CTGCTAAGCCGCTTGTCTACCACCTTATGCACCTTAACGCATTGACCCCTTAAGCAGGTCGTGCTCTTACGTCAGCTGTAACGGGGCACCGGAGCAACTC
ATTGGACAACCAGCGTGGAGCTACTACCACCGACAGCAGTGCTAGTGGTGCCTCGCTACCTCTGTGCAAACGCGCAGAGGAAGGTAAACAACTAGAGATA
GTCTAGTTGTTGGTAAAAGTAAAACTGTACTAAATATAATTAAGTCCTAATCATTAACCTATGTTTTAGTCCTAACTTAATATATTTATCTACAAAAATG
TATGGTAAAGTCTTGCTCACCACTCATTTCGCGCGTCAATCGTTGATTGGACCGCTAGAGCTGGCTGACATGGTGACACACATCAGCCAATCGGTGAGTG
TTCCGAATATTACCCCTTATGGTAATATTCACAAATATTATCAACCTTTATGATAATGTTCGAATTAACAAGTATCAAGGGTTAATTACATGTGATAGGC
TCACCCCGTTACATCAGCACTCATATCCTTGTTTTTTTGTTACAAACTCAATGCAGTCTCCAATAGATGTGACTACACTGGCAAGGCAGTTCCAGAGAGT
GATGAACTAGCAGTAAGTTTAGTGTGAATACGCACAGCCGGATACGTCGCTAAACCGCATTTATCTCTTTTTCTTCTCGAAAGTCAGTGCTTTAGGTATA
AGATATAGGGAAATGTTAACCACCCACTAGGTTTTCGTTAACCACCACCACCCCTATTTATTAGCGTAATTTATGCAATTTACGCCTTCTGGTTGGTATG
ATTGAGAATATCAAAGTTCTCAGAAGTATTTTACAATCTCGTTTACACCACCACCCCTATTTATTAGCGTAATTTATGCAATTTACGCCTTCTGGTTGGT
ATGATTGAGAATATCAAAGTTCTCAGAAGTATTTTACAATCTCGTTTACAATTTGACGCTTGACCTACAGTTACCTACGATATCGGACGTACCATTCTGG
CGGCAGTGGTCGCTTTTTACGTATTTACCAGACATAAGGTTTAGCCGCCGTGATTGCGATACAGGACGGTATGTCTGGCTCGTTCAGGTACGACAGTGAG
ATTAGCATGACTTGAATTCTTGTGAGTACCGCTATGTGCACTTCCTAGCGCGTTAACTGCCTTCGAGGCTTTTTCACGCACTGCTCCGTCGCGGTTGGTT
GCTATCGTAATCTTGAACTGCCTCACACACTTCCGATCTTATCTTCTAGTGGCGTGACCTCTACTGCTTGGCGTGTGTACTCAACAAGGAGTCCTTGTAA
CGACAGACTAAGGGGATCCAGATCCCCATACCGACCCCATAGGCCGCTCATTTCATGTCTTGATCGAGATACCCAGGCGCTTCAACCACAACTCCTGTAC
ATATTATTAGGCAATGGCCACCCGGTCTGGCTCAGCACCCTTAAACTATCGTATTGTGCCGTCTAGATGCGCAGCCATTTGGCCACACCTTATCAGCTGC
TTATTCTCTTGCCGCAGCTCTGGTAGCCGAAGCTCGGACGCTGCGTGTGCGTCACGGATTTGCATAATGCGCTTGTTAGCAATAGCCACAGTTAAATAGC
GTTGCCTACTGTACTCATTCAGACGGTATGACAATTGCTTTGATAACAGTTTTCGAAAGAGCAGACACGCACCATTAGGATCTCTTTGCTCTATAGCTTT
ATGTAATATTGACCTCTTGCTCGATTATTAAACCTCAACTCTGAACCTTGATCTCTAGTGGGGATATCAACGTCCTGGACGGCGCTATGTGAATACGGGG
TGCTTCACGTATTTCCAGTCCCATTCCTTTCGGCGCAACTCGATTGTAGGCCAGTAGTGGTAGTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCTTCGGTTTACTATTGATCGAAATGGTTTGCAGTCGCACC
ATCTCACGGTTGCCTAGGCGTTCCACGACATACAAAAAGTCATCCGACGTGTTTGTCAGCTTACCATTAACTTCCACGAGCCAAGTGGTTGCCCGCAAAC
CGTACTTATGCGCTGGAGCCTAACACATCGTGGCAATATACGCCCCTTCTCTGAAGCCGCTTGACTGTATGTGGACCTCAGTGCCCATAGCTGAGAGTTG
AAACGTGCTTACACTCATACTCATTTCCTTCCGATCGCGCATTACCAAAACATCAACAGTTGTTTTACCATCCACTGCGACTTCCACGTCCGCACTCCCG
TACCACCACTCGCCCGTCAATAGCTAACAGCAAGTCACCGCTTTCGAATTTTTTGGCGCAGTCCGTGCCAGCTGCACATCGCTTGATTCCGAGCACCTGA
CGCTTATCCTCGTAGCACGACTTAAGCTTTTGGATCCGTCCATCCAGAAGGCCAAGGCCAGGTCTTGCTTTTGATAATGGGTACGTCAATAGTTGTGCTG
GCAAAATGTTCAGCGATACCGGGATTCGAGACGCCCGAACGTCGATAATAGGTCGGACTGTACTGACTGGTAGCCCACGAAAAGATTCTTTGCGACCAGC
ATTATCCTGATAGGAAATTGGGAGCCATAGCGCATTTACAGCGCCAGCATCATTGATAAAAACACCTCCCACGGACTTTGTGATACGGTCAAAATGCAGC
ACCTCAACGTTGCATGCTTTATATCTTGGTGGCTGAAAGTCGCGCAGAGCAAGACGGTCTAGCTTGGTGACGACAGACTTCATGGTGACGACGGTTCAAT
TACTACTCAATTCAACGTAGTCGGCGGTCTCGCCAACTTCTAGCACTTTCTCAGCCAACACAACACTTTTGATATGGCTTGCTACAGCGCCCAATGGGTT
GGGATCGTATTGTACGATAGAGTAATTGTGAATTGGGTGCACAAAGACCACTTTGGCCGGGACTTCAAAGGTCGCAGCAATTGTAATCAACACGTCACCC
AACGCAATAGGGACAGTGTTCTGATCCACGACTACGAAACCCTGCTCTCCATCCACCACAACTTTCATACCATGGTAGCTGGAGCTCGATATGCCGTCAA
TCATATAAGGAATGTCAAAAGACACCATTACGAGCGACCGCAGCATCTTATTGCCCAGTGCGTTTCCTCCGGGAAAACTCAACGGCGCAGGGGCAGACGT
CGGATGTCCAGTATTGACGAGATGTATTGGCGCATCATCTCCGGTCGGTGTGTCCCCGATATGTGACTCTGCATGCCATAACCCGTCTTGGTCGTTCCGC
GTGCACAACTGCATTGGAAACCATAAACGATCCATCATAATCAAGGCTGTGCGGACACGGTGGTGATCACAATCATAAAGTATCGTAATACTGTGCGAAA
ACCGTTAGGCAGCGATGCCATGACGCGCACAAAGTCATCCAGCGTTGGGGTAGGCTGTCCCGCCACGGAAGTTATGATACAAGGTTGGGCCAAATGCGCT
TTCATGAACATATAGTCAGCTTGCGCTGGGTACACACCACCCACAGGCAGTGAGGCATTGTGAGCTTGGTGGTAGGATAACGCGTGCACAATACCGCCTC
CGATTTCCATGTACTTGTCCGGCGTGATTAAATGTAAGTTCTGAACGTGAAGTGTGACTGTGTACTGGTCGCCTCCACGCTGAATCTGAACTTCAACCGC
TTAGCAACATGAGAATCCAAACCCCTTAATAGTCAAAAAGGTCGCAGCGTACTTGCCAGCAAACTTTATAAGCACGTCTCCAGTGCACAGCTGATCATGC
GCCGGCCCCCCTTGAATGACCTGGTCCGCTACTAGCATGCCTGTCTCTTGCGAGAATTGCTGACGCACCAATACTTCTGTTTCTCCCAACAGCCCAAGCC
GCACTTCGTTAAACGCTGTATGGCGAAAAATCGTTTGAATATTACCGCGTGACACTTGTTGACTCTGTTGAATCAGCTCCATCACACGGACAACGCGATT
CAACGGTAGGTAGAATGATGACACTGCCTTCTTAGCTCCTCCGGCGTTCAGCGCGATGGCACATCCGTCAATATTCAGGACAGGAGAGCCACTCGAGCCT
CCACTTGTACTGCTCGCTGCTGCAAAGTAGAACGTGTTGAAGTCGTTGTACGAACTTGAGCTGTAGGACGGTGCGTCACGATCCAACTTGGCCAAGATTC
CTGGCAAGATGAAGAGTTTTTCTCCAGCGTCGTTGCCCACCACGCGGATCTCAGCACCAACTTTGGCCACATCGCGCCTCAGTGGGATCTCATGCAGCTC
TGTAAACTTGACCTTGCTAGGGTCAAAGCGGAAGAAACCAAAGTCATGCACATGGTCTCGGTACACCGGCACAAGATCCACCTCCTCCTTATTGAGAAAG
ATGGCATCAGCCACCACTGGACCAGGTGTCACCACATGTCGGTTTGTCAGGATCAACCCCCTTTTCTTGTCCACCACGAAGCCCGTGGCCACGCTAAAGC
TCGCGCCATTGCCGTCGAATGCGCGCACACTCAGCAGCCGGACGCTCACAATGGCGCGAATGCACTTCTCCAGACTTTGCAGCCACAGCTTCGACTCGCC
CGTAGACGCTTCCACGCTGTAGTTTACGGACGGAGCAGTGGACGCAGAGCAACTCTATTTGACGTCTTGTTGGTCATCTATCTCACTGGCTCAGTCACTG
GCTCAGCTTGAAGCTTTACCGGGCGCTACGGTACCGGTTATATCTGCGAATCAACAGTATAATAGCGATATCCAGTTGCAAGTTTTAAGGTGTGACAACG
GGTATATTGCTGGCTTCGTAATCTTTTAGCTAAAACAGTCCTCCCCACTACACCAATGGCAAGTTCAACTATGTGTTTTGCCAACGTGCTTTTTCTGCTA
ACTCTAACGTTAGTTGCAGTTATGGACAGCATTCCTACACACTACATTCTTCCATCTTCTCTTGACCTGGTCATCCCTCATCCGCAGATAGCTATGCGAT
TTTCTCTTCAGATTGTGCGGGCCTCGATGTTTCGTGCTTGCCCGCGATGTAACGGGGTGCCTCCGTGAAATGATAATTTACATAAGGTAAAAATCAAGTA
TGAATATTGCGTTAGGACAAACACAATATTCTCACAATATCATCCTAATAGATAATATTGCCTCGCAGATGTAACACACTACTCATTGGTTGATATAGGA
TCGAGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAATGAGTGGCGCGCAGATAGTTATAATACATGTTTGTTTGTATTTAGACATAGTCAA
ATGAAGTCAAATAGGGATTTATTACAAGGATTAACTATACTAAATACAGTTCTACTTTTTACCTTTACTGAGTACTCTTACTCCGTATAGCAATCTTCCT
CTGCACGTACGTGTACGTGAGGTAGTCGGACGCACACACCCTTGCACTGTAGGCAGTGTAAGGTTTATTCAGTTACTTGAATAAGGTGTGCCCCGTTACA
CCTGGTAGCACTTTGTAAGTCCATTCAACGATCATGAATCTGTTGGACGATGAGGAGGATGATTTCCATCCCACGCATGAAAGCTACTCCCATTTGAGTC
AAATCGAATGGGACGCTGTCGAACGCTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCGCACTGCTGTCCGCCCTGAGGCCAGACGGACAGCACGCCAC
CATCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGCGGGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAACAGACGGAGCTGTCGAGAGAACAT
AGTGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCAACGTGTATACGTCGACCCGAGACTCTAAATATTGACATCTCAAAGT
ACAAAGGAGCCGATGAAGACTCTCTATTGAGATGGTTCGTGGAACTGGACGATGCCATAAGAGCTCGTCATATCGTCGATGAAGAAATGCATATCGCATA
TGCGGTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCGATATGTCTTTGGGTCGTTGGAAGTCGTCAAGTCCC
TGCTAAGGCAAACTTTTGAGCCTCCTCGAGCGGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGACGTACGCTCGTACATTCA
GTACATACGTCACCTTACCAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAAGTCTGACTGATGGTCCTGTTAAAACCTACCTGTTC
CGATTGGAGTTCAACACCCTAGAAGAGGCAATAAGGGTTGCGGAACAGGAGAACTTCAGCGTGAACAGGCTCATGCGAATTCGAATTCCTATCGTCCATC
GAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTCACGCGAGGAGCGAGATCTCTCGTGTTAACAACTACAAGAAATTGCAAAAATGCAAT
AGATGTTAGAAGACAGGGCATTATGCATATGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGAAACAGCAACCGCCATGCGGCCAAACGATGTC
CAAGGCGTGGGTCCGACGTTGTTGCGAAAACGCAACAACGTAACGGACAGCAAAAAAACGGTCAGGGTCAGTAGGTATGGAGCGCCCTACCGATTCAGCA
ACGTCAAGTGAGTTTGCAGGCCTCTTGAAAAAAGTTGCTCCCAACACTCAGTCATTGTGCGTTGCTGCTTCTGGTAATGAGGTTTCCCTCATTACCTTGA
AACTCGAAGTGACACAAAGCATGTCGCTTCGAGCCCTAGTCGATTGTGGGGCGTCGAACAACTTTGTACGACGCCAATCGCTAGACAACAGAGAGTTCGA
ATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATAAAACGTGTAGTGGGTATTCTCTTTACA
CTTAAAGAAGTCCGATATGATGATGACTTCATCATATTGGACTTGGGTGACATATTTGATGTTATCAGTGGTTTATCGTGGATCAGAAGGTACGAGCCAC
AATTCAGCTGGCATCGACGAACAGTCGACATGCCTGCCGCTTGTTCATCAGACTACCATCAGATGAACGTCTTGGAGTGTCCATCATCATGTGGATGTAC
TACGAGCGAGTGTGATGGCCTCGCGTGTGGTTTGGTCGTTAGCACGACTGCACATGGCCATGGAGTGGCTGATCGCCACACCATGAAGCCAGATTCCGGC
GACTGTATTGAGATGCAGGTCGCACCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGGATGTTCTCCAAACGGACAACACCCAAGTAACA
ACGAAACGACTGCCAATGATTGGCAATACGATGATCTTAGTGCAGTTGGATAATCGCACGTAGAAGACCTGGCCGCGGTAGCGCAACCACCGCCAGAGGA
TAACGAGGGAGCAATTCCACTGTGTCATATGATGATATAGCTCAAGAAGCTAGTGAGGGAATAAGTCCCCATCCAACTGTGGACATTAGTTTCCAGGAGA
CAACAGAGACATTAAATGTCCTAGTCAA