Description :
From Genome Similarity Track
Location :
Scaffold_191:9282- 14678
Transcript NameFunction/comments
Hyaar_Emoy2812267Ankyrin-2
Hyaar_Emoy28122683-beta hydroxysteroid dehydrogenase/isomerase family protein
Hyaar_Emoy2812269autophagy-related protein, putative

Sequence
5396 bases(100 bases per row)
ACGGGTCGCTCCCCTCTACACGTGGCGGTAGCAAGCGGTAAAAAGGACGCGCTTCGAGTTCTTCTGGCTGCTGGCTTCCCCCCAGAGCATCAGAGCAAGA
GTGATATGGGTACAGAAGCAGAAAATCGGTCTGCCTATGCGTTGGCTCAAAAACTGAAGGCTCAGGATTTGCTGGTGGTGTTCCATCAGTTTCTGATTCA
ACAAGTTGCAGCCAATGACGTGTCAAGTATGAACCAGTTGCTGGCTTCCGGAGTGGACGTGGGTGTCAGAGATGAAGCTACTGGAGGATCGTTGCTGCAC
TGGGCGGCGTCCTGTCAAGCTGTGGACGTGATGAAGGAGCTACTAAAGAGGGAAGATGTGCAACGACTCAAGCTGGTGAATGCACGCAATGGAGAAGGTG
CTACGCCGCTGCACTTGGCGTGTCAGGCAAACCAAGTGGAGTGTGTAGAGATGTTGCTGAGAAGTCATGCAGACGTGAGTTTAACAGGTGACAAGGGGCT
TAGTAAGGATAAAACAGCACAGGAGCTGGCTACTAAGCCAGCGGTGCTGGAGTTGTTTTCTCGAAAACGTGAGATGATTGACGCTGACAACAATTCAGAG
AAAACGCAGATGGATGATGCAAATAGAGGAAACAAAGGGGAGAGTGTAGCGACGCTGATGGCAACACAAGATGGACAAGGTGCATCAGAGGCTGATGTGC
ACGAAGTCCGGAATGAGTCTTTGCTGTTGCAGCTTGAAGAGAAGAATTTGCTGGTAAAACAGCTGAAAACGACTATTGAAGCGCTTGTGCAGGAACGGCA
AGAAACACGGATGCTTGGAGAAGAGCGCGTTATGCTAGATTATGTCCGTAAGCTGCGCGAGGAAAAGTCGATCATTCAGAGGCAGCTGGAGGATGCCAAC
GATTACATAAAAGACCAACAACTACAACTGGAAAGTTTGAAAAAGCAGATCCAATTGACAATGTCAGCGGTCGGCAAAGAGGTACGCAGCGCTGTATCTT
GATGTCAATATATAGAGGGTGTGTTCTTATAGGTGCTCTCCTTTTTGTACTAGCATGAGACTGACCGCGACATTTTCTCCCAAACTAGTGATGCCGCCAC
AACCGGTACCGCAATCAGTCCTCCGGATAGAAGCCACAGCAGTACGAGCCTTGTGAATTCGCATCAAGCTGAAACACAACCAAATAAAGGTAGCAGACCA
GAGGGACCCCATGCGCAACCGCTGAAGCTGGATGCCTGGACGTCCAAGGCGCAGCGCGAGCAGGAAACCTTGAATCGACACATTGACAAGCACGGCCCTG
GCATTTGGAGTACTGTATGGAACGGTCTCTGGGTTGGACCTGGCGAGTTGTCGCAGGACGCAGAGGACGAGGTTGTTATAACGGTGTGAAACTAATTACA
ATGATTTGCGCAGCTCCACTATTGCAAAGCAGCAGAGCAACGGATCGTCGTTGGAGCAGACATGGTAGTGGCTTCCTGTCGGCGTTTGTGAACGTTGGTT
GACGATTCTTCGGCTGCATATACGCAAAGCAGTTGTCACTGCACGCCCGCAACGAGATCAAACCTGATCCTGTCTACTTATCACATAAGCAGTGACCGTG
AGTTCCTAGCTGTAGTTCGAGTGTGTGACAGCTTGAAGAGATACAAGTGATTAAAAAGTCTGCATTCCGTCACGTCTTACGAAAGCAGGTTGGTCCAGTC
TCGTTACTTGGTGCTGGTCAGAAACCGTGGTAAAGAACCTTGGATTGATAGTTTTAGGAAGCGCAAATCAAGTACGAGATGCTCGCAACTGTGGAGGTTT
AACACAGAGAGGGTGATTTAGTACGCAAAATCTATCATTCCACAATGTCTCTTTATTGTCCATAGTCTCCTGTACCAATAACCTTGTGATACATTCACGA
AAGCTGAAGCGAACTCGGAACTCGACTGCCACAAAAAGACTGCTCCTTATCCTGTGTTATCCAAAATAATCGTGTACAAACATTGCATGCACACAAAATC
TGAACCATCGCGCAACCGGGTACAAAAAGTGTCCGTTGCAACATATCGCGTCGATTTCTACCGGTATAATCGCGACTCGGGACCAGTAAATCGTTCCAAG
CCAGCTAGCTTGTTAAGTATCCATCAATCACTCGGATCGGACCAGCAATCAAAGATGATCGCCGCAGCAGCTCAGCGACTTCGATCGAGTTCCATGCACG
CACTGAGGGCCTACGACAAGAGCGAGCACCGCCTCCTCGTCGTCGGTGGCAGCGGATTTGTGGGTAGTAACATCCTTCAACGCGCCGTGCAAAAGGGGAT
CGAGGTGCGCAGTCTTAACCGCTCAGGCAAACCGCAGTGGCAGGACGTGCCGTGGATTGATCAAGTGGATTGGCGCTCGGGGAGCGTCTTCAATGAGGAG
GATCTGGCGGAGGCTGTGGAAGGTGTGACTGGTGTCAGTACGTGTCAAATACTAAAGGTTGAAGCAGTGTGCACTTGCACTGACGAGTATCTAATCATCA
TCAAATTGGGTCTGTTTGTGTCTATTTCTCCCTGTTTGTAGTCTCGACGGTAGGTGCCTTTGGAAGCCAGGAGTTTATGGAGAAAATGTGCGGAGACGCG
ACGATTGAAGTGGCCCGGGCGGCACAGAAGTCGGGCGTGGAACGATTTGTGTTCGTGTCCAACTCTCGCGTCGGCTCGTGCTACCCGTCGTGGCTACCGC
TGTATGGCTATTACCATGGAAAAGAGCGAGCAGAAGCTGTCGTGCAAGCAAGGTGAGGAGATTTGAGGTGTGGAAGCTTTCTTTGTTGAGGTGGATCTTT
TTCTAATGTTCGGTGGTTGATGGGTGTTGTAGCTTCCCAAGTACAGGTGTGGTACTGCGTCCAGGCTTTATCTATGGCTGGCGTCGGACGGCGAAAGGAC
AAGGCATTCCACTCCAACTCGTTGGTGCCCCTGTATCGATGCTTGCACGCAACCTTGGTGCCGTGTCAACTGCATTGGGCTATGTGCCATTCGTTGGGGA
GGAGATGCAGGCTGCTATTCCTGTTGATGCAGTTGCGAAGGCGGCAGTGCTCAGTGCTATCGGTCCCGTCCAAGGACAAATGCTGGATACAACCAAGATG
CTTGAGGTAGCTGCTTCCTTCCACGTCCATGGGTGAGATACTTGCAAAGGACATCATGGTAGCTGAAATGTACCAGAACCTCTGCAGGTAGAAGAGGCTC
CCGCCGCATTGTAAACGAGAGTACGATCTACATTCGGACGCAGCTGGTGTTGTCGGAAATCTTCGCTAATGTTGCCACCTTCATGCTGTCTCGGGCTTGT
AAGTCATACCGATAACAGCGCTCTGCGCTCCTCTGTTCAGTCGTTCCATTATCGCTGATAAAGTAGGCCGAAACAACGTACACTCTTAACCACATCTGTC
ACTTCTTGTGCAGCTCTTTAAACATAACAAATAATCCGTAGCGTTGGCTGAGAGACCATGTAAATATCCAAATTTAATGCTCGTACCTATTTGACCCATC
TTGTCCCGAGTAACCCAATCACCCCAGCAGCGTTGCGATTGGGTACGATGTTGAAGTGGCCACACGATGCTCCTTCTCGAAATGTGATTGGCTATATTCG
ACTCACACAACCACCGAATATACATCGACACACGCTTTGTCGATACGATAACATGAAGAGCTCCATAAGCAGCCCCAGTGACCTTCTCTTCCTGAATTTC
AACCAGGACGCCTCGTACGTCCGCCCACATACAGAAACACTTATCTTCTTTTCTCTTCTTCATTAATTATTATCGATTCAATACGAAAAAATGCTGACGG
GTGCTCGTTCTCTGTAGATGCATCAGCGTTGGCACTCGCCAAGGGTTTGGTATCTACAACTGTGAACCATTCAGCAAGTGCTTCCAGGAAGACATTGGGG
GGATCGGGATTGCTGAGATGCTGTATTGTACCAGTCTTGTGGCTCTGGTTGGTGCTGGAGATCAGGTAGGTCACGTACACAGCAAATGGGTTGTGAGTGA
CAAGGCCACTGCTATTTACTCTCTCACGTGTGAATAATCGCTTCTTCTTCTGTTTTTATTGTACATTCTTTAGCCTGCGTTCTCACCGCGTCGACTGCGT
GTGTGGAACACCAAGACGGGAGCAGCAATATGTGATTTGAACTTTGTCACGGCCGTGTTGGCCGTGCGTATGAACCGACAGAGGTACATTGCTCGTGGTT
GGAAGCCTGACCTTAGATGATAGAGGATAAAGATACGTGTGAGTGAGTGAGATTTTACTGATGTAAACATGTTCTTCTGGCATAGGTTGATTGCAGTACT
GGAGCGCAAAATTTACATCTTTGACATTAGTACCATGAAGATTCTGGAGACGTTGGACACGTCCCCGAATCCAAAAGCGTTGTGCGTGCTCTCTCCGCAC
GACAATGGACATCTAGCTTTCCCCTCTGGAGCTATGCCAGGAGAGATCGTGCTGTATGATGCCAACAACCTTGGTGTGTTGAATGCATTTCAGGCACATC
GCATGGCACCCGTGGCTATGGCATTCAACATTCAAAGCACACTACTTGCAACAGCTTCCGAGTCGGTAAGGAGCCTTCGATGACGATTTGTTTTTGATCG
AGGTTTGCAGTAACCATGTTGCGATTTGTGCTGTAGGGAACACTAATTCGTGTGTTTGCCGTTCCAAGTGGGACAAAAGTTGCGGCTTTTCGACGAGGGT
CCTATGGTGCTCAAGTCTACTGTCTAGCCTTCAACGAGAGCTCCACAATTCTGTGTGCTTCGAGTGACACAGGTACCATCCACTTCTTCTCTCTAACTGG
GGCGGAAAGTTCGGCTACAGGTAGCTTCGGTCATTTCACGCCGATCACATTTACACTGGCTGTCGCTGGAAGCACCTTCGGCTCCACGGTCTTCGGCAGT
GCTGCTGCTCCATCCAACGCGGTCCCAACAACCGTTGACTCTTCGCCTGGTAAACTCTCGGCAAATGCTGCCAACGTCAGTACCACGACACGAACGACGC
GTAGTACCAGCTCTGCTGTCAGTAATTTCGATGATGTGGCTGGCGTCATGAGCGCCTACCTTCCCAGCTCCTTTTCGGGTATCGCCGAAGGAACTCGCGA
TTTCGCCTATGTAAGCAATACGTTTCTGGAAGTTGACGAGGTTGCTTCACTTTCAACCGGTTGCTAACTTGTTACTTCCAGGCTCGACTTCGCTCAACTG
GAGTGCCGAATCAGTGTGCGATCCACGGTCCTAGGGACAACGATAACCCGATCGTACAGTTATATGTCGCAACTGCCGATGGCTACTTTTACGAGTACTC
GCTGAACCTTACTATCGGAGGCAAATGCAAGCTGGAACGGGTACGTGACTTTCGTCTTGCTCGTCTTTCGTAAACTCATCATCGTGTGCTTTCTTG