Description :
From Genome Similarity Track
Location :
Scaffold_518:9282- 13933
Sequence
4651 bases(100 bases per row)
CGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGCTGTACGGGCCAGATCCACTTATGCGGAAGGCCTC
ACCGTCAATGAAGCAGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAACTTGG
TGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACGCTGTTACGGCAGAAGGTGATGGTCCATCTGCGCGGTTGGATGAATCACGA
GTTAGTACATGTCAAGCGAGATTGGAATGCCAGTGCGGACAGCTTGGCCAGTGCCGCTTTACGAAATCAATGTGGTGTTGAGGTGGAGAAAGAGGCCGAG
CATCAGAATCTCGTTACGTTGAACCGACTAGATGAGGTGATGGTGGTTGGATCCGGGAAAAGGGCAGTCCAGGTAATGGTTGTCACTAGGTCTAGGGGAA
GGATTGGATCCGGCTCCAAGATCCTCGATGAAGCATTGGTGAAGAGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAAGAAGCGTGGATCTTGGG
ACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAATGGATCTGAATGAC
TTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGGGGACCGGGATGGATTGGTGAGACTGGTGATGCCGGAAACCTTACAACAGGACGTCCTACATC
ACTACCACGCTAGTTTAGAAGGCGGTCATCAGGGTATTGGTCGGACCAATCAGCGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCATGAAAGTACA
ACTGTAATGGGCCCAACTCCAATTACATAAGTAGGTAGATATTTCCTTAGTTATTACATAAGTAGGTAAAGTGGCACACGGGTAGCGTGTGCCAAGGTGT
CATCATCTGATTGGTTGATAGTGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGGGTATGACCCGCTACTGCCTCACCA
GAGCTGAGCCCTCCTCTCTCGAGGAGGCATTTGCACTCGCGATTCGCGAGGATTACATGGTCGCTGCATCGTACGCCGCAGCCATACCTGCGGAAGCCCG
AGAGTCTACCCCCGAGCCCATGGAGATCGACGCCATCAACGCGTCGAGCGATCGACGTCGCGGGTCCTACCGCGGCAGCGCTGGGCGAAGCAATCGTTCC
CTCATTTGCTTCCGCTGTGGGAAGAAGGGTCACCGCGCGGCGGAGTGCCGCGCGCCAGCTCCCGTCGTCTCTCACGTCGACGCGGAACACTCCTCGGTCG
CTCATTCAAAAAACGACCAAGACTAGTAGGTGCGGGGCGCCCTACTGGCTTTAACGAAGGACCGGGCCCTCCGGTGGCAGCCCAACCTTCGAGCCCTCCC
GTGCTCCAAGCACACACCAATGCCACCACTACGCCGGGCGACTCGAGACTGATCATTGTCAGCCTCCACGTCACCGGTGCCCGGCGACCGCTGCGCGCGC
TCCTTGACTCAGGAGCGACCAACAACTTCTTTCGCGCGTCGTGTTTGTCGGTACTACCCAAGAACGTCCGCGTCCGGAATGGTCCGGGCGAGATCCAAGT
CAAACTCGCAGATGGTAAGGCTCGCCGCTTTGCGCGGCGTGACGTGTCTTTGTCGTACACGTTCGACGGCTTCCGTAGCAAGGACGACTTCTTGGTGATC
GAGATGAACTACGCGTTTGACTGCATCCTGGGCATCCCTTGGCTTGCGCGATATCAGCCAGAGATTGACTGGCTGGCCCAATCAGTCAAGCGTCGACGTG
GATTCGACGTGAGCGAGGTCTTCACACACCTCTTGGTGGCGCCAAGAGACTGGGCCCCACGTCACAGTCGTCGGCAAAACAGCAACGACACAAGCAGTGC
ACAGAGCGAGCGATGGCCCTCTCTGCATGGCTTGTGCTACGTTGCTGGACGAAGAGCCCTCGCGGCTTTCGCGAGGTAGATGATGAGGTGGATGAGCAGC
GGCTCCCACAATACTAGACGGTGGTCGAGCAGGGTCTCCCACACAACGAGACGGCGGTAGAGCAGAGGTTCCCGCCGAACGATTCGGCGGTCGAGCAGAT
TGGGCTCCCGTCAAACGATACCGCGGTTGAGCAGGGGCTCCCGCGTGTTCCCGGCCCGGTCGAGTACGGTCTCCCGCGCCTAGAGGAGGGTGATGCATCG
TCGAGTAGCAGTGCGTCAGACTCGAGCGTAAGCTCGAGGAAGTCGAAGAAGAAGTCGAAGCGACAACGCCTGAAACCTCTTCGAGACTACACGACCAGCG
ATAGCCCGTCGATGGAATCGGTCAGCGCGCTGGAGTACGTGGAAGGAGGCCCGAATCGGTCGCGCAGCATCGCAATCGCGAGCCCGCCGCGCGAAGCGGC
GGCGATCACCCGCCTTCCAGGCTTGTCCTGGTAGAACTTTCTTCGGGACCTCAAGGCTGGAGACGTCGAGCAAGTATGCTTGGTCACCGAGGCAGTCTCG
GTGGATGAGGCAGCAAATGCGGTCGCAACGGACAGTGAACGTTCACGTCCGCTAGGTGCTGAACCTAAGTCTGCTCGAGAGGAACGATTCCAAACGCAGT
CTTGGGAGCCCTTGCGGGAGTCAGCGAATCCCGTATACGACACCGCCTGCGAGTACACCGACGTCTTCCCGGATGAGATCCCCGCCGAGCTACCGGCGGA
TCGTGGGGTTCAGCATGAGATCGACCTCGCGCCAGGTACGAAGTACTGCGTTACCAGACAATGGCCACTTCCGCGTGATCAAGTGAAAGCGATCGATGAC
TTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTGAGAGTACCTCTCCCCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCTACAGGGGGATGGCGTA
TCGTTCACGCATTCAACAAGTTGAATGATGCCACCATCCCCGCGCAGACTCCGATCCCTCGGAAGGATATGGTACTGGACTCCATGGCTGGCAGCGTCAT
CTACAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCTGATGAGAGCATCTGATGTACCTCTCACCGCCGTAAGTACACCGAGCGGGATGCTCTGG
GAGTGGCTCGTGATGCCACAGGGCCTCAAGAACGCGCCTGCCACCTTCAATCGCATGGTCTCCCATGTGCTTCGCCCGCTTCGAGACTTCGCGCCGAGTT
ACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGGCAACCTCAGTGCCGTAGACGTACATCTGAAACACCTGAGACAAGTCTTCCAGGTGATGCGAGA
GAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGCGCGGATCCC
GAGAAGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACACGAAGA
ATTACGCTGGGTTGATCCAGCCGCTGTCCTCGCTGCTGAAGAAAGACGTGA