Description :
From Genome Similarity Track
Location :
Scaffold_3031:928- 2682
Sequence
1754 bases(100 bases per row)
CGAAGACAGAAGGACTACCAGGTGAAAGAGGGGTCGCGGTGCTTGGATCCAATGGTGGATCCGACGAGACGGAAGATGAACAAGTCTGTTTCCATGAAGG
CGGGGATCTACACGCCAAGGATCTCGGGGATGGCCTGGCGGTAATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGAT
CCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGC
CCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGTACCTCAGTTCCGAGAAAAACTATCAGATCTG
ATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTC
TGTGCATTGATTACCGGCTGGTTAACGGTCTGACTTGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTG
GTACTGCTCTCTTGACATGGTCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAG
TGGAACCGGATGCCGTTTGGATTGAAGAATGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAA
GGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACAT
CGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGAAGGCGTGTACTAAGTGGAAAAACTCTATCAGTGTG
GTAAAGAGCTATTGGGGAATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAAGACCTGTCTTCGTTAGCCG
ATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGT
ATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGA
AGGGATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGATGACGG
ATCAGAACATGGAACAGGCAGAATCGCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTAACTT
CGATCCGGAACGTCAATCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTATCATCCAGTCACC
TTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTACGGAGCAGTGGAGAAAGAGATACTCGCCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTG
CTAGTGGGAAGATCCATCCGGATCCTGAATCAGACACTCTACGTTAGCCTGGCT