Description :
From Genome Similarity Track
Location :
Scaffold_417:92789- 94535
Sequence
1746 bases(100 bases per row)
GTGGTCATCGCAGCAAAATCTACCTCTCTCAAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCC
AAGAAGGATTGCATCGTTCGTAGCGACTGTGGGAAGGACAAGTCTGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCCTTGGAAACTCGA
TGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGGTTCCACTTAGTACACGCCTCCAGTAAGGAGGTTACTCTTT
CGCACAACTGATCCCACGATTCCGCCGGGGTTAGAATGGCGTCGTTATAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGC
TTCGAATGGATCCACTTCCGCATGATCTTTCCCGGATCCACCCTGTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGCGTTGG
TAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCA
TAGTCACCACCCAGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACAC
CATTAATCGAGTCAGGCCGTCAACTAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCATGGG
GACGTTGAGATACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCCGATCCGATAGTTTTTCTCGGAGCTGAGGCGCCACCTTCCGCACCTTCTGAGCGA
TCGGTCTCGCGTCGCCGACATCGATGTCACATTTGACTCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTC
GGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAGGGGCTGACCCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCATCGCTTGG
ATCTCAATCCGACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCTCGCCGGGGCCTCCCCTTCTC
CGACAGATTCAATTTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAGCGACGGGATCCCACTGACACATATCCAGGGCGCCTAGGGATACC
GTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCT
TGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCT
CGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAAAGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAG
TGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAAC
CAGTACACCAAACAACCTGCAACGTGATCTTGATCCGCGTTCTCCC