Description :
From Genome Similarity Track
Location :
Scaffold_43:9270- 11577
Transcript NameFunction/comments
Phyca_LT153450656putative polyprotein

Sequence
2307 bases(100 bases per row)
gcggcgggtcagcgaccttacaagtaccgctcaacggtttacgtgccgttccacgtttgtccataggacacagcggcgggtcagcgaccctacaaacacc
gctcaacggagtacgtgccgttacacatttgtccataggacacagcggcgggtcagcgaccctacaaacaccgctcggcggataacgcgccaccccgcgc
acgccctgtgagtcacactcacggcaaacagcaacttcgttgctcactaactctgacattccaatgtccagcaccatgaccgattcggtctcgtgctcgc
gccaatagcgcttctgtctccgagcagaggtgggttcatgactcgccaatgctccgctaggagacgggcgcgtagcgcccaacgtcttcgacttccagtc
gatccatggctcgaggctctcgagccacgccataccaaggatgaggtcatacctctcatccaggtctaagaccaagcagcgttccacgctatcgaagtct
aagaacttcacgttaaggtcaatagagaccttcgacactgtcactagtgtccccgtcgcaagacggacagagatcttatctcttcgaggctccttcagag
cctccgcatacggtttaaaaccgtcaacagtggagcgccggacatagttgtcggacgcccccgagtcgatcaagactctccacggcttgtcgaagccttt
cacgttcgcttgaacgactagcaagccgggcttgcactcaccacgtgagtaagagagcttagctctctgcggggctgagtcccgttctctcctgcctccc
agaggcccaacagaactcagttcttccccagtagggcgccccgcgcctactgggttccgtcgtttccccgcgacgaccctggttgagggttcgaagcggc
gcttcggctcgatggagcctgggccttgttgcgcaacgggcaactaggcctcaaatggcgggtgcttccgcacgtatagcatcgacggatgctggagcgc
tgctcagcagcatagaggtcagcctcgtcttcagcgtggctgaggtccatcggttcaggaccgctcgaagagcgcgcgctaccagcgctcggacccagtc
tcgcagactggaagttatagtcggcattcaatgccacgttcacggcctcctcgaatgaggcagggtgaacacggaaaacttccgttcgggcagcgcccgt
gcgcaggccctccataaacacggtcactgcgaccgcctcggggagagggctcgacgccataccggcgatcagagttctcaactcttggacatagtccatc
aactcctttttaccctggcgggtagcgaggaacttcgaccgtatacggtacgcctggttaggcggcgcgaatacgcgcactagttgctgtttcagctgat
cccaagtcgggaaagcagcgtccacagacgtgccgcacgttagtgcccactcttgagctcgtcccccgagcttcgagatcgccagcgctacgcgctgttg
ctcagtctggagcagggccgatcccatggccatctcgacctgtcgggtccagagaaggaggttctccccttccttcccctcgaaggtcttcacgctcaac
atgagcggtttcggtctattagaccactcgtgcgtcgacgacgcggccgcggacgatgcggcggacgccgttgcgctcacgcgctcttgtacatgctcta
agagcgccttctcgtagcttgcaaaagcctccagtctggcggacaccgcctctggcccttgcgaagcaagatgagcaatgccctcggggaccaacagaga
cataagctttttaagcgtctcttgttggcctggcggcaagctcgcgaacacagcgtgttccatcctctcagagggatcagtcaaaagactcagtcgcagg
attgactacaagtgctaccaagtgcagcggggctgccgtagcttatcgtcagaggaagacggttaactcaacgagttaaggattaacacacaccttatta
agggttaataggccttaagatccgaaggcacctactaactacgaccttaataaaaggacttttcactttgtgttctaaatccaaactgtttatttatctt
tttattgcggctagccgcctagggggtaaatgtatgtggttaactatctaacatagtaaaaccaaatgaaatcctacttcaaatgcataacgtgtggctc
tcagccacacacactccctcgagtgtccgtacatcaactatgtaccttacacaaagtgtatccatgtgtggaacacaccaggtgtaaacccgtgtaaccc
cgttaca