Description :
From Genome Similarity Track
Location :
Scaffold_1820:927- 3102
Sequence
2175 bases(100 bases per row)
CTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGACGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCT
GTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGGTATCCT
CCACAACGCGATTAACGCGTTCGGTTTGACCATCGGTCTGCGAATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCA
GAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCA
CCATCAATGGTGTCCGGCACTGCCGCTAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATGCCCGTGTTTCCCGCCTTATCCTTGGGAAGGCC
AAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACAC
GTTTCACACGTGCGTACATAGGTGCCGACCCCCTTATACATCTTGGGCCACCAGTACATCGAGCATACCGAGCCATAGGTCTTCTGCCGACCTAAGTGTC
CGCCCACGGGCGTATCATGAACCTCGTTGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTA
GTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCATAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACGCTTCGCTCCCAAGAGCC
CGTAGCAGCACTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCATGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCG
GCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCT
CTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACT
AGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCC
CTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGG
AGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACTTTCCAGCACCATGGTGCGTCCTTCTTAAGTAGATCTGATAATGGCCGA
GCCATCTCCGCGTAGTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGA
TGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTT
GGCATACAACTTACTAGTGCACATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACG
AATATTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTG
GGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGA
AGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCT
ATGAAGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGC